Ana səhifə

Изследване на взаимоотношението растение-патоген при блатното кокиче


Yüklə 0.96 Mb.
səhifə1/5
tarix24.06.2016
ölçüsü0.96 Mb.
  1   2   3   4   5


СЕЛСКОСТОПАНСКА АКAДЕМИЯ

АГРОБИОИНСТИТУТ


Лилия Николова Георгиева



ИЗСЛЕДВАНЕ НА ВЗАИМООТНОШЕНИЕТО
РАСТЕНИЕ-ПАТОГЕН ПРИ БЛАТНОТО КОКИЧЕ (LEUCOJUM AESTIVUM L.)



АВТОРЕФЕРАТ

НА ДИСЕРТАЦИЯ ЗА ПРИДОБИВАНЕ НА ОБРАЗОВАТЕЛНА И НАУЧНА СТЕПЕН “ДОКТОР” ПО НАУЧНА СПЕЦИАЛНОСТ РАСТИТЕЛНА ЗАЩИТА

шифър 04.01.10

Научен ръководител: Доц. д-р Виолета Кондакова

София, 2012

Дисертационният труд съдържа 150 страници, съдържа 48 фигури и 20 таблици. Списъкът на използваната литература включва 258 заглавия, от които 235 на латиница и 23 на български език.

Защитата на дисертационния труд ще се състои на от часа в залата на АгроБиоИнститут (бул. “Драган Цанков” 8).

УВОД

Блатното кокиче (Leucojum aestivum L.) е един от най-интересните видове от биологична и стопанска гледна точка, тъй като е с установено високо съдържание на алкалоида галантамин (активното вещество на нивалина). Галантаминът намира широко приложение в индивидуални или комбинирани лекарствени форми като мощно антихолинестеразно средство. Използва се с успех при лечение на болестта на Алцхаймер.

Естествените находища на блатното кокиче в България са ценни заради високото съдържание на галантамин в тях в сравнение с популациите в други балкански страни. Почти липсват сведения за патогени при блатното кокиче като изключим няколко съобщения за гъбни болести в изкуствени насаждения преди повече от 10 години. Не е ясно дали има други и по какъв начин влияят на продуктивността на растенията. За да се отговири на тези въпроси са необходими значителни предварителни сведения за моментното състояние на естествените находища, както и да се получи достатъчно материал за изследвания. Тъй като растението е защитено от закона, а и се размножава бавно в естествени условия, най-добрият алтернативен начин е микроразмножаването му in vitro.

По тези причини целта на дисертационния труд е в малко по-широк смисъл от заглавието на разработката. Настоящата дисерация е разработена в 4 основни етапа:



  1. Проучване състоянието на естествени находища на блатно кокиче

  2. In vitro размножаване на блатно кокиче

  3. Взаимодействие на блатно кокиче с патогени

  4. Фитохимични изследвания, които се провеждат във връзка с всеки един от предходните етапи.



ЦЕЛ И ЗАДАЧИ



Целта на настоящия дисертационен труд е комплексно биологично характеризиране на естествени популации от блатно кокиче (Leucojum aestivum L) в България и проучвания върху факторите, определящи синтеза на галантамин и взаимодейтвието растение – патоген.

Реализирането на поставената цел се сведе до изпълнението на следните основни задачи:



  • Обследване на естествените популации от блатно кокиче (Leucojum aestivum L) в България и подготовка на проби (листа и луковици) за анализи.

  • Приложение и адаптиране на in vitro технологията за поддържане, размножение и съхранение на блатно кокиче.

  • Създаване на in vitro и ex situ колекции за съхранение на генетичен материал с автентичен произход.

  • Събиране на растителен материал с патогенни симптоми.

  • Идентифициране на патогени чрез електрономикроскопски и молекулярни методи.

  • Анализ на взаимодействието растение-патоген чрез изкуствени заразявания на in vitro луковици.

  • Фитохимичен анализ на алкалоидния състав на in vitro материал и на образци от естествени местообитания.

  • Метаболитен анализ на здрави и изкуствено заразени in vitro растения от блатно кокиче, посредством GC-MS анализ.

МАТЕРИАЛ И МЕТОДИ

1. Обект на изследване –блатно кокиче (Leucojum aestivum L.) от 33 естествени находища на България.

2. In vitro техники, използвани за размножаване на Leucojum aestivum и създаване на in vitro колекция.

2.1 Стерилизация и въвеждане в in vitro култура - по twin-scaling метода (Popov and Cherkasov, 1984).

2.2 Основни хранителни среди, използвани в настоящата работата за растежа и развитието на блатното кокиче in vitro – табл. 1


Табл.1. Варианти на хранителни среди за култивиране на блатно кокиче при in vitro условия



2.3 Съхранение на in vitro култури при ниски положителни температури.- една година при температура +4 Со

3. Взаимодействие между блатно кокиче и бактериални патогени

3.1. Сканираща електронна микроскопия – използван е необработен свеж in vitro материал, сканиращ микроскоп (модел “JEOL 5510”).

3.2. Изолиране и идентифициране на бактериални патогени

3.2.1. Изолиране на бактериални патогени от луковици на блатно кокиче - Направени са изолации по метода на Rudolph et al. (1990) в Институт за защита на растенията, Костинброд. Бактериалните изолати са подържани на хранителни среди:LB (Bertani, 1951) и КВ (King, 1954)

3.2.2. Определяне на основни характеристики на бактериалните изолати


А) Макроморфологични характеристики – Определени са макроморфологичните им характеристики, чрез наблюдение на колониите на светлинен микроскоп (увел.4х, 8х).

Б) Патогенитет - За определяне патогенитета на бактериите са подбрани тест растения, като тютюн, който не е гостоприемник; лук - универсален гостоприемник;

В) Реакция на свръхчувствителност - определна върху листа от тютюн по метода на Klement, 1963.

Г) Симптоми при различни гостоприемници - Симптомите се предизвикват след изкуствено заразяване чрез набождане на люспи от луковици на блатно кокиче, зюмбюл, лале, нарцис и минзухар.

Д) Определяне реакцията на изолатите по Грам: според Ризванов и др., 1977.

Е) Секвенционен анализ - Изолирана е тотална ДНК от бактериалните изолат чрез GFX Genomic Blood DNA Purification Kit (AMERSHAM BIOSCIENCES). От нея се амплифицира гена за 16s рибозомна РНК, като се използва универсална двойка праймери F1- 5’- GGAGAGTTAGATCTTGGCTCAG и F2 - 5’-AAGGAGGGGATCCAGCCGCA - (Ponsonnet аnd Nesme, 1994) (http://www.microsynth.ch/). При амплификацията се получава продукт с големина 1479 бд . PCR програмата е: 5min-94 oC, 35 цикъла (1 min-94 oC, 1 min-55 oC, 2 min-72 oC); 15 min -72oC.

PCR продуктите се разделят в 0.8 % агарозен гел в 1х ТВЕ буфер, 100 V, за 1h. За пречистване се използва кит (GFX PCR DNA and Gel Band Purification Kit, AMERSHAM BIOSCIENCES), а секвенирането е проведено в лабораторията на Института по молекулярна биология на университета Zurich-Irchel, Швейцария.

3.3. Анализ на взаимодействието растение –патоген чрез изкуствени заразявания на in vitro луковици


При изкуствените заразвявания са използвани in vitro луковички от 7 клона с произход: Присад, Свиленград, Виница 1, Виница 2, Палаузово, Ямбол, и Кочово, Блатец във фаза първи лист, нарязани на половинки.

Избрани са 4 бактериални изолата, чиито вид е определен чрез секвенционния анализ. Това са:



  • Изолат 1 - Serratia plymuthica , Изолат 3 - Serratia plymuthica,Изолат 5 - Rahnella aquatilis,Изолат 6 - Bacillus subtilis

Начин на заразяване: За всеки вариант сa използвани по 12 половинки от луковички (надлъжно срязани). Нарязаните половнки се поставят в петрита със стерилна филтърна хартия, напоена с МS макросоли. Накапват се с по 10-20 µl бактериална суспензия. Контрола: накапани със стерилен разтвор на МS макросоли.

Култивиране на заразените експланти: Вариантите от изкуствените заразявания (растение–бактерия) се поддържат в култивационно помещение за 9 дни. Развитието на инфекциозния процес се отчита на всеки 3 дни (3, 6 и 9-ти ден след заразяването).

3.4 Определяне въздействието на бактериалните изолати върху метаболитите на растенията - изкуствено заразяване на in vitro луковички с произход Блатец, заразени по същия начин и със същите изолати, описани в предходния абзац. За всеки вариант са използвани по 15 половинки от луковички. След 9 дни инокулация пробите са обработени за анализ на метаболитите им чрез GC-MS .

За паралелен метаболитен анализ и на бактериалните изолати, бактериалната маса е лиофилизирана и обработена по същия начин, както заразените луковички.



За краткост пробите от различните варианти са означени със следните кодове:

Вариант

Брой проби/вар.

Код

Контрола (незаразени луковици)

5

К

Луковици, заразени с изолат 1

5

1bk

Луковици, заразени с изолат 3

5

3bk

Луковици, заразени с изолат 5

5

5bk

Луковици, заразени с изолат 6

5

6bk

Лиофилизиран бактериален изолат 1

2

1

Лиофилизиран бактериален изолат 1

2

3

Лиофилизиран бактериален изолат 1

2

5

Лиофилизиран бактериален изолат 1

2

6


  1   2   3   4   5


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©atelim.com 2016
rəhbərliyinə müraciət