Ana səhifə

Supplementary Fi


Yüklə 31.44 Kb.
tarix26.06.2016
ölçüsü31.44 Kb.
Supplementary



Fig. 1. Nucleotide sequence of MhGR-RBP1 cDNA and deduced amino acid sequence. RRM at N-terminus is shaded and glycine-rich domain within C-terminus is underlined. Two conserved regions (RNP1 and RNP2) within RRM are underlined and marked below sequence. Predicted protein sequence is shown beneath nucleotide sequence. Numbers at left indicate positions in recovered nucleotide sequence; those at right show amino-acid positioning from N-terminus. Initiation codon (ATG) and stop codon (TAG) are underlined in bold, and stop codon is indicated by asterisk. Arrows indicate primers for cloning cDNA.



Fig. 2. Multiple alignment of amino acid sequences of MhGR-RBP1 and other plant GR-RBP proteins. The plant GR-RBPs used for alignment were MpGR-RBP1 (M. prunifolia, ADG96008), Pa-RRM-GRP1 (Prunus avium, AAL13082), AtGR-RBP7 (A. thaliana, AAD23639), OsGRP3 (Oryza sativa, AAT85299), ZmGR-RBP2 (Zea mays, NP_001151562), CuGR-RBP (Citrus unshiu, BAA92156), GmGR-RBP (Glycine max, AAD48471) and TaGR-RBP (Triticum aestivum, BAF30986). Deduced amino acid sequences were compared via DNAman program. The N-terminal RRM domain and C-terminal glycine-rich domain of GR-RBPs are indicated by red and black dotted lines, respectively, below multiple alignments. Identical amino acid residues are shaded in green. Strongly conserved residues and weakly conserved residues are show in purple and yellow, respectively. Gaps introduced to optimize alignment are indicated by dots. RNP1 and RNP2 motifs are indicated with red boxes. Four β-strands and two α-helices arranged in β1α1β2β3α2β4 fold with side chains are marked with black lines, respectively. Amino acid residue numbers are indicated on the right.


Fig. 3. Comparative phylogenetic analyses of MhGR-RBP1 with apple, Arabidopsis, and rice GR-RBP family proteins. Unrooted tree was inferred by MEGA 4.0 and neighbor-joining method after full-length amino acid sequences of MhGR-RBP1 were aligned with apple, Arabidopsis, and rice members. MhGR-RBP1 is indicated by triangle. Numbers on branches indicate percentage of 1,000 bootstrap replicates that support adjacent node; values <50% are not indicated. GenBank accession numbers for apple, Arabidopsis, and rice GR-RBPs are listed in Table 1.

Table 1 Members of the GR-RBP protein family found in apple, Arabidopsis, and rice

Gene

Identifier

Domains

Size (aa)

Homology (%)

Mass

(kDa)


Isolectric point

Localization

MhGR-RBP1

ADQ08684

RRM

164

100

16.19

6.36

nucleus

MpGR-RBP1

ADG96008

RRM

171

96

16.69

6.36

nucleus

AtGR-RBP1

AT2G16260

RRM

185

50

20.05

6.16

chloroplast

AtGR-RBP2

AT4G13850

RRM

158

52

15.70

6.72

mitochondria

AtGR-RBP3

AT5G61030

RRM

309

50

29.98

4.87

mitochondria

AtGR-RBP4

AT3G23830

RRM

136

53

14.13

8.68

nucleus/

mitochondria



AtGR-RBP5

AT1G74230

RRM

289

53

28.73

4.61

mitochondria

AtGR-RBP6

AT1G18630

RRM

155

46

15.96

9.89

mitochondria/

cytoplasm



AtGR-RBP7

AT2G21660

RRM

176

80

16.89

5.86

nucleus/

cytoplasm



AtGR-RBP8

AT4G39260

RRM

169

75

16.58

5.58

nucleus

AtRZ-1a

AT3G26420

RRM: C2HC

245

54

26.92

8.93

nucleus

AtRZ-1b

AT1G60650

RRM: C2HC

292

46

34.40

8.56

nucleus

AtRZ-1c

AT5G04280

RRM: C2HC

310

48

33.49

9.13

nucleus

OsGRP1

Os01g68790

RRM

150

48

15.55

8.01

chloroplast

OsGRP2

Os03g56020

RRM

141

20

16.29

8.21

mitochondria/

cytoplasm



OsGRP3

Os03g46770

RRM

162

81

15.90

6.30

nucleus

OsGRP4

Os04g33810

RRM

137

46

15.10

9.93

nucleus/

mitochondria



OsGRP5

Os05g13620

RRM

104

53

11.49

8.03

nucleus

OsGRP6

Os12g31800

RRM

258

56

25.04

4.74

nucleus/

mitochondria



OsRZ1

OS03G61990

RRM: C2HC

205

57

21.82

8.29

nucleus/ mitochondria

OsRZ2

OS07G08960

RRM: C2HC

308

56

33.25

9.31

nucleus/ chloroplast

OsRZ3

OS03G47800

RRM: C2HC

308

48

34.04

9.05

nucleus



Table 2 Primer sequences and sizes of amplified products for MhGR-RBP1 and reference genes in quantitative real-time PCR and semi-quantitive RT-PCR

Gene name

Accession number

Primer sequences (5'-3')

Amplicon size (bp)

EF-1α

DQ341381

(F) ATTCAAGTATGCCTGGGTGC

174

(R) CAGTCAGCCTGTGATGTTCC

actin

GQ339778

(F) CCAAAGGCTAATCGGGAGAA

105

(R) ACCACTGGCGTAGAGGGAAAG

18S rRNA

CN995444

(F) CCTGCCCTACTGCCGCTA

172

(R) GGAAACACGCAGAATCAATCA

MhGR-RBP1

HQ380209

(F) CGTCGTGAGGGTGGCTATG

119

(R) AAAGTCCCAAACCACCTAACAC


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©atelim.com 2016
rəhbərliyinə müraciət