Supplementary materials and methods

tarix	18.07.2016
ölçüsü	46 Kb.

SUPPLEMENTARY

MATERIALS AND METHODS
PCR and Southern blot analysis of pymif transfectants

P. yoelii genomic DNA was isolated as previously described (1). Diagnostic PCRs were used to confirm the successful transfection of the parasites. For Py17X-MIF(+) parasites, the following PCR primers (Figure S2) were utilized: i) 5’ integration site: forward primer A (5’-aacctggttgatcttgccag-3’) and reverse primer E (5’-tttcccagtcacgacgttg-3’); ii) 3’ integration site: forward primer F (5’- GATATCATATGATGCCTTGCTGCGAATTAATAACAAAC-3)’ and reverse primer B (5’- taaaaatgatccttccgcagg -3’); iii) the presence of Tg-dhfr: forward primer C (5’- cgggatccatgcataaaccggtgtgtc -3’) and reverse primer D (5’- cgggatccaagcttctgtatttccgc-3’); iv) the presence of genomic and transgenic copies of pymif: forward primer F and reverse primer H (5’- GAATTCTCGAGTTAGCCAAATAGTGAACCACTAAAA -3’); v) the association of the Pbef1 promoter with the pymif transgene: forward primers G (5’- ggctgtctagcggaaatacagaagctagc -3’) and reverse primer H. For Py17XL-MIF(+) parasites, the following PCR primers (Figure S3) were utilized: i) the presence of Tg-dhfr: forward primer (5’- GGTCGTCGCGATGACCCCCAAGAG-3’) and reverse primer (5’- GATTCCAGGCAGTCATGAGCATGCGACG -3’); ii) the presence of pydhfr: forward primer (5’- GAGAACGGCACCGTTATGAT -3’) and reverse primer (5’- TGTTCCATTAGCTTCCCATATTC -3’) and iii) the presence of genomic and transgenic copies of pymif: forward primer F and reverse primer H as for Py17X-MIF(+) parasites.
Integration of the pymif transgene construct into the P. yoelii genome was assessed by Southern blot analysis. For Py17X-MIF(+) parasites, DNA was digested with Hind III and Stu I to confirm the presence of Tg-dhfr/ts. A 1.7kb Tg-dhfr probe was prepared from the pPyMIFcon plasmid by PCR amplification using the primers: Tg-dhfr (forward) 5´-gccactctttccccatgcaaagct-3´ and Tg-dhfr (reverse) 5´-CGCCCGTTCGGTCATCCATTGTCC-3´. To confirm the integration of the pymif transgene, Py17X-MIF(+) DNA was digested with Hind III and Pst I. A 1 kb pymif specific probe was prepared from the pPyMIFcon plasmid by PCR amplification generated using the primers: pymif (forward) 5´-CCACACACAAAAGGTGAATAATAAGTGGG-3´ and pymif (reverse) 5´-GTGCGAATAAAAGGCATTATTTTTTTCGGT-3´. For Py17XL-MIF(+) parasites, genomic DNA was digested with EcoRI or with PstI and KpnI to analyze 5´ integration and 3´ integration respectively. The 5´ integration was checked using a Tg-dhfr probe generated from the pPyMIF/OE plasmid using the following primers: Tg-dhfr (forward) 5´-GGTCGTCGCGATGACCCCCAAGAG-3´ and Tg-dhfr (reverse) 5´-GATTCCAGGCAGTCATGAGCATGCGACG-3´. The 3´ integration was checked using the same pymif probe as for the Py17X-MIF(+) parasites above. Probes were radiolabeled with α-³²P-dATP (800 Ci/mmol, Perkin-Elmer, Waltham, MA) by random priming using the Prime-It II kit (Stratagene). Digested DNA was blotted onto nitrocellulose membranes and hybridization was carried out overnight at 63^oC and 61^oC for Tg-dhfr and pymif probes respectively. High stringency washes were carried out at 65^oC (Tg-dhfr) and 63^oC (pymif) in the presence of 0.1X SSC (15 mM NaCl, 1.5 mM sodium citrate) and 0.5% SDS. Hybridized bands were visualized by autoradiography.
REFERENCES

1. Vaidya, A. B., and A. P. 1987. Tandemly arranged gene clusters of malarial parasites that are highly conserved and transcribed. Mol. Biochem. Parasitol. 22:249-257.

Supplemental Figure Legends
Figure S1. Schematic diagram for generation of Py17X-MIF(+) transgenic parasites. A. Genomic c/d rrna ssu locus of P. yoelii 17X parasites targeted for integration of a pymif transgene. B. pPyMIFcon targeting vector containing c/d rrna ssu sequences flanking the tg-dhfr gene and Pb-ef-1aα-pymif cDNA expression cassette. C. Predicted genomic organization following a single integration event of the pPyMIF(rrna) targeting vector into the c/d rrna ssu locus. D. Genomic organization obtained following the integration of two copies of the pPyMIF(rrna) targeting vector in tandem into the c/d rrna ssu locus. Letter A through H represent the location of primers used diagnostic PCR analysis, along with the expected sizes of the resulting PCR products. H: HindIII, S: StuI, P: PstI, E: EcoRI, K, KpnI.
Figure S2. Analysis of Py17X-MIF(+) transgenic parasites. A. Analysis of diagnostic PCR products on a 0.7 % agarose gel obtained using genomic DNA from wild-type P. yoelii 17X (lanes 3, 5, 7, 9, 11) or Py17X-MIF(+) (lanes 4, 6, 8, 10) parasites and the primer pairs denoted in Figure S3. In Py17X-MIF(+) parasites, i) primers C + D confirm the presence of the Tg-dhfr gene, ii) primer sets A + E and F + B show correct 5´ integration and 3´ integration respectively, iii) primers A + B show that either the c or d rrna small subunit gene locus remains intact, iv) primers G + H and F+H confirm the presence of the pymif transgene. B. Southern blot analysis of genomic DNA from wild-type P. yoelii 17X (WT) or Py17X-MIF(+) (Tg) parasites digested with HindIII and PstI and probed with radiolabeled pymif gene showing the integration of the pPyMIFcon targeting vector in tandem into the c-ssu rrna locus. C. The expression of pymif gene was measured by quantitative RT-PCR in ring, trophozoite and schizont stages of Py17X-MIF(+) parasites. pymif mRNA levels are expressed relative to PY07409, a 60S P. yoelii ribosomal protein gene.
Figure S3. Schematic diagram for generation of Py17XL-MIF(+) transgenic parasites. A. Genomic pydhfr locus of P. yoelii 17XL parasites targeted for integration of a pymif transgene. B. pPyMIF/OE targeting vector containing UTR sequences flanging the pydhfr gene and Pb-ef-1aα-pymif cDNA expression cassette. C. Predicted genomic organization following a double crossover event replacing pydhfr with the pPyMIF(dhfr) targeting vector. D. Genomic organization obtained following the integration of the pPyMIF(dhfr) vector into the targeted locus by a single crossover event in the 5’ pydhfr UTR. The red and orange lines represent the Tg-dhfr probe and the pymif probe respectively used for Southern blotting. E, EcoRI; K, Kpn I; P, Pst I.
Figure S4. Analysis of Py17XL-MIF(+) transgenic parasites. A. PCR analysis of P. yoelii 17XL (WT) and Py17XL-MIF(+) transgenic (Tg) parasites using Tg-dhfr specific primers (top), internal pydhfr primers (middle) and pymif primers (bottom) showing endogenous and transgenic pymif gene copies. B &C. Southern blot analysis of genomic DNA from P. yoelii 17XL (WT) and Py17XL-MIF(+) transgenic (Tg) parasites digested with EcoRI and probed with Tg-dhfr probe showing 5´ integration (panel B) or digested with PstI and KpnI and probed with pymif probe showing 3´ integration (panel C).