Ana səhifə

Project Title: Molecular methods for virus detection in fruit plants


Yüklə 205.5 Kb.
səhifə4/6
tarix26.06.2016
ölçüsü205.5 Kb.
1   2   3   4   5   6

Basic protocol for immunocapture-PCR (IC-PCR)

Thermofast PCR plates (Advanced Biotechnologies) were treated with crude antiserum diluted 1:1000 in carbonate coating buffer (100 l per well) and incubated for 5 h at 30 oC. Plant tissue (0.1 g) was homogenised with 2 ml PBS/TPO (phosphate buffered saline containing 0.5 ml/litre Tween 20, 20 g/litre polyvinylpyrrolidone (mol. wt 44 000), 2 g/litre ovalbumin). The homogenate was centrifuged at 13 000 rpm for 3 min in a minifuge. Antibody was removed from the plates by inversion and the plates were washed with 120 l PBS/Tween per well. 100 l of extract was placed in each well and incubated at 4 oC overnight. Plates were washed with 120 l PBS/Tween per well three times, using a pipette to transfer fluid.


PCR was performed as a one-tube protocol in a 25 l volume containing 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1.5 mM MgCl2, 0.3 % Triton X-100, 0.25 mM each dNTP, 5 pmole each primer, 0.25 units AMV Reverse Transcriptase (Promega), 0.5 units DNA Polymerase (Red Hot Taq, Advanced Biotechnologies). Reactions were overlaid with 50 l mineral oil and incubated at 42 oC for 45 min and 94 oC for 2 min followed by 40 cycles of 94 oC for 1 min, 60 oC for 1 min, 72 oC for 2 min, then 94 oC for 1 min, 60 oC for 1 min and 72 oC for 5 min. 5 l of each reaction was analysed by electrophoresis in a 1.5% agarose gel containing 0.5 g/ml of ethidium bromide and pGEM size markers (Promega).
Table 2. Primers for amplification of ASPV. The nucleotide positions of primers refer to ASPV isolate PA66 (accession no. D21829); primers are designed to regions in either the coat protein (C.P.) or the polymerase (RdRp) genes.

Target

Primer

Primer sequence

Primer Position













Poly A tail

anchor

CGGGATCCGTCGACAAGCTTTTTTTTTTTTTTTTTT




Adapter to anchor

adapter

CGGGATCCGTCGACAAGC
















Diagnostic C.P.

ASPV1

ATAGCCGCCCCGGTTAGGTT

9237-9256

Diagnostic C.P.

ASPV3

CTCTTGAACCAGCTGATGGC

8993-9012

Diagnostic C.P.

ASPV5

ATGTCTGGAACCTCATGCTGC

8873-8893

Diagnostic RdRp

ASPV F1

AGCGGTTGCCTATTTTTGCTCC

3480-3501

Diagnostic RdRp

ASPV R5

GTGAGGTCAAAGATGCTGAAACC

3748-3770













Coat protein

ASPV7956

ATGACTTCCAATGGATCCCA

7930-7949

C.P. (Pichia pPICZB)

SPFB

CGCGCTCGAGGATGGCTTCCAATGGATCCCAGCC




C.P. (Pichia pPICZA)

SPF

GGCGAGCTCGAGAAAAGAACTTCCAATGGA




C.P. (Pichia)

SPR

CAGATGGGACCTATGTACCGGACATCC
















C.P. (E.coli pQE70)

SP70F

CGTTCAAGCATGCCTTCCAATGGATCCC




C.P. (E.coli pQE70)

SP70R

ATTAATAGATCTCTTCCTAATAGATAAGAC




C.P. (E.coli pQE40)

SP40F

CGTTCAAGATCTACTTCCAATGGATCCC




C.P. (E.coli pQE40)

SP40R

ATTAAAAGCTTACTTCCTAATAGATAAGAC




Immunocapture-PCR for Apple stem grooving virus (ASGV)
ThermoFast plates (Advanced Biotechnologies) were coated with 100 l antiserum (Loewe) diluted 1:200 in carbonate coating buffer. Young unfurled leaf samples were ground in PBS/TPO buffer and the extract diluted to 1:400. They were incubated in the plates overnight at 4 0C for immunocapture to occur. A two step RT-PCR, based on Jelkmann and Keim-Konrad (1997) was carried out using primers designed to regions in the coat protein gene.

Reverse transcription: 20 l reaction containing 4 l of 5x reaction buffer (Promega), 1.25 mM each dNTP, 35 U ribonuclease inhibitor (MBI), 20 pmoles oligo dT primer and 0.5 U AMV-RT (Promega). Reactions were overlaid with mineral oil and incubated at 37 0C for 1 hour.



PCR: 50 l reaction containing 3 l of cDNA, 1x PCR buffer (Gibco BRL), 2 mM MgCl2, 0.4 mM each dNTP, 0.4 pmoles of each primer and 2 U Taq (Gibco BRL). Reactions were overlaid with mineral oil and cycled in an OmniGene PCR machine (Hybaid) 95 0C for 90 s followed by 35 cycles of 95 0C 30 s, 60 0C for 30 s and 72 0C for 60 s. 10 l of each reaction was analysed by electrophoresis in a 1.5 % agarose gel containing 0.5 g/ml ethidium bromide and 1 kb DNA ladder (Gibco BRL).
Primers SGTL4 and SGTL5 were used initially to amplify a 664bp region (nucleotides 5594-6257 isolate P209 [Yoshikawa et al 1992], accession number D14995) from the coat protein coding region of 11 different ASGV isolates. The resulting PCR fragments were sequenced directly so sequence data presented is of the most common variant. Despite the high degree of similarity over this coat protein region (96.6-99.6% at the nucleic acid level) the European apple isolates cluster together into a cluster that is distinct from P209, the Oriental pear and citrus tatter leaf isolates (data not shown). Diagnostic primers SGTL6 and SGTL9 were designed to areas of complete nucleic acid homology between the 11 isolates sequenced although there is one mismatch in each primer with respect to P209. An ASGV diagnostic product of 424bp is amplified by this primer pair (nucleotides 5762-6185 isolate P209).


Table 3. Primers for amplification of ASGV.


Target

Primer

Primer sequence










Diagnostic

SGTL4

GAGAGGATTTAGGTCCCTCT

Diagnostic

SGTL5

CTCCTAACCCTCCAGTTCCA










Diagnostic C.P.

SGTL6

AAGGTGAAAGCTTTGAAGGCA

Diagnostic C.P.

SGTL9

TCAAAAGCTTTGGGCCATTTC










C.P. (Pichia pPICZB)

GVFB

GCCGCTCGAGGATGGGTTTGGAAGACGTGCTTCAAC

C.P. (Pichia pPICZA)

GVF

GGCGAGCTCGAGAAAAGAAGTTTGGAAGACGTGCTTCAAC

C.P. (Pichia)

GVR

GGCGAGCTCGAGAAAAGAAGTTTGGAAGACGTGCTTCAAC












Immunosorbent electron microscopy
Carbon-coated electron microscope grids were floated on drops of crude antiserum, diluted 1:500 in phosphate buffered saline pH 7.2, for 10 min to coat with antiserum.

The grids were rinsed by floating on distilled water in a 5 ml plastic cup and were then floated on plant extract (0.1 g/2 ml) for 20 min. After rinsing, the grids were floated on antiserum diluted 1:50 to decorate virus particles. The grids were finally rinsed, stained with 1.5% aqueous ammonium molybdate and examined in a Jeol JEM 100S transmission electron microscope.



Isolation of dsRNA from N. occidentalis
The dsRNA extraction procedure is basically as described by Valverde (1990). However, dsRNA was extracted from 7g of ASPV 7/40 infected N.occidentalis leaf material and only 1 cycle of cellulose chromatography was necessary. After extensive washing with 1xSTE containing 16% ethanol, to remove contaminating ssRNA, the retained dsRNA was eluted, collected and concentrated by ethanol precipitation.

Construction of an immobilised cDNA library from dsRNA template
200ng ASPV 7/40 dsRNA was captured onto Dynabeads oligo(dT)25 (Dynal) after denaturing at 100C for 5 min and incubating at 65C for 2 min. First strand cDNA synthesis was carried out using AMV RT (Promega) according to the manufacturers instructions. The RNA is melted (94C for 1 min) away from the cDNA leaving a reusable solid-phase cDNA library. Second strand synthesis requires a sequence specific primer and several ASPV primers were used (ASPV7956, ASPV F1, ASPV5, ASPV3 and random primers). This second strand cDNA was used as the template for PCR amplification (50 cycles: 94 for 45 sec, 50 for 45 sec and 72C for 2 min).

1   2   3   4   5   6


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©atelim.com 2016
rəhbərliyinə müraciət