Ana səhifə

Table S6 Cloning and identification of


Yüklə 26.33 Kb.
tarix26.06.2016
ölçüsü26.33 Kb.
Table S6 Cloning and identification of LcActin
S 6-1Total RNA isolated from Litchi chinensis Sonn. cv. Nuomici


S6-2 Primers and Reference

QLcactinF : ATGGCCGATGCTGAGGACATTC(5’→3’)

QLcactinR : TCAGAAGCACTTCCTGTGGACAATG(5’→3’)

Full-Length:1134bp

ReferenceXu JT, Zhang Z, Peng RH, et al. Cloning and analysis of MrACT from Malus micromalus. Journal of Fruit Science, 2008, 25(3): 289-292

S6-3 Electrophoresis result of PCR segment

Lane 1:DL2000 Marker;Lane 2:PCR segment

S6-4 DNA sequencing (Beijing Genomics Institute for sequencing)

Result:(Full-Length 1134bp, Red letters represent binding domains with the primers)



atggccgatgctgaggacattcagcctctcgtttgcgacaatggaactgggatggtgaaggctggatttgctggggatgatgcccccagggcggtgtttcccagtattgttggtcggccccgacacactggtgtgatggttggtatgggtcagaaggatgcctatgttggtgatgaggcccaatcgaaaagaggtattcttaccttgaaatacccgattgaacatggtattgtcagcaactgggatgatatggaaaagatctggcatcacactttctacaatgagcttcgtgttgctccagaagagcacccggtgcttcttactgaggctcctttaaatcccaaggccaacagagagaagatgacccagattatgtttgaaacttttaatgtgcctgccatgtatgttgccatccaggccgtcctctctctttacgccagtggtcgcacaactggtatcgtgctggattctggtgatggtgtgtctcatactgtgccaatctatgaaggatatgcccttcctcatgctattctccgtttggacctggctggtcgtgatctcaccgatgcattgatgaagattctgaccgagagaggttacatgtttaccaccactgccgaacgggaaattgtccgtgacatgaaagagaagcttgcctatgtcgcgctagactatgagcaggaacttgagactgccaagagcagctcctctgtggagaagaactatgagttacctgatggtcaggtcatcactattggagctgagagattccgttgcccagaagtcctcttccagccatctctcatcggaatggaagctgctggtatccatgagactacctacaactccatcatgaagtgtgatgtggatatcaggaaggatctctatggtaacattgtgctcagtggtggttctactatgttccctggtattgccgaccgtatgagcaaggaaatcactgcccttgccccaagcagcatgaagatcaaggttgtggctccacctgagagaaaatacagtgtctggattggaggatcaatcctcgcatctctcagcaccttccaacagatgtggatttcaaaggatgagtacgacgagtctggtccatccattgtccacaggaagtgcttctga
S6-5 Alignment and phylogenetic analysis

Accessions

Description

Max

score

Total score

Query coverage

E value

Max ident

AAP73457.1

actin [Gossypium hirsutum]

754

754

99%

0.0

99%

ABR45727.1

ACT1 [Actinidia deliciosa]

753

753

99%

0.0

99%

ADA70361.1

actin [Persea americana]

749

749

99%

0.0

98%

AAA80356.1

actin-2 [Arabidopsis thaliana]

749

749

99%

0.0

98%

ACN54541.1

actin [Carica papaya]

748

748

99%

0.0

98%

ACJ04738.1

actin [Sedum alfredii]

743

743

99%

0.0

97%

NP_001054419.1

Os05g0106600 [Oryza sativa Japonica Group]

743

743

99%

0.0

97%

AAW78915.1

actin [Triticum aestivum]

741

741

99%

0.0

96%

BAD27408.1

actin [Nicotiana tabacum]

741

741

99%

0.0

97%


This gene sequence has been submitted to the NCBI GenBank and the accession number is HQ615689.


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©atelim.com 2016
rəhbərliyinə müraciət