Ana səhifə

Supplementary Table Chromatographic gradient conditions for the hplc analysis of phytohormones


Yüklə 254.47 Kb.
səhifə1/3
tarix26.06.2016
ölçüsü254.47 Kb.
  1   2   3
Supplementary Table 1. Chromatographic gradient conditions for the HPLC analysis of phytohormones

IAA and NAA(detection wavelength 280nm)

Zeatin and BA(detection wavelength 267nm)

Time(min)

Methanol(%)

Water with 0.5% acetic acid (%)

Flow(ml/min)

Time(min)

Methanol(%)

Water(%)

Flow(ml/min)

0

3

97

1

0

3

97

1

60

67.7

32.3

1

38

63.6

36.4

1

61

100

0

1

39

100

0

1

71

100

0

1

49

100

0

1

72

3

97

1

50

3

97

1

80

3

97

1

60

3

97

1

Supplementary Table 2. Regression equations and linear calibration ranges of phytohormone

Phytohormones

Y=aX(ng)+b

R2

Calibration range (ng)

IAA

Y=2068.3X-45962

0.9966

50-1000

NAA

Y=2593.5X-37611

0.9956

50-1000

Z

Y=2928.3X+54630

0.9982

50-1000

BA

Y=5275.5X+28600

1.0000

50-1000

Supplementary Table 3. Primer sequences for the quantification of transcripts by RT-PCR

Gene name

Forward primer

Reverse primer

MdPIN1

CGTTTACGGGATGTCTGCG

GCTTGCCCATTAGCCCTCTTT

MdPIN2

CCAAGCCCCAAACACGGATAT

CAGCCCGCCACTCGTAGACC

MdPIN3

ACGCATCAAGGCGGTCACTC

TACCGTCTGCGCGGGATAAA

MdPIN4

AAGCTCCATGTCACTGTCAGAAAAT

CTCGGACTCGCATTGCTCAT

MdPIN5

ATGATTGGGTGGGAAGATGTTTACA

TTATGAGCTTAGAGATGAAGTCGGC

MdPIN6

CGAATCCGGCGCTCTACCT

TGCTGTGAAAATCTCCCCGTC

MdPIN7

GCGGAGATTTACAGCCTGAGC

GGGAGGACTGAACCGAATACAA

MdPIN8

ACCATAAAGTTCACCATCACC

TGTGACATTCTTGTTCTTCAAC

MdPIN9

CGTCTCCACTCTGCCCAACACTC

CTGTCTTCCGTCGAGCGACATAAT

MdPIN10

CTGGACCAAAGTCAGCAAAAGGG

AGCGACATAATATCGGAGTCGACGT

MdPIN11

AGAACCACTCCAAACCGACGC

CCCCAAATCCACCTTGAAAACT

MdPIN12

CTAAGGAATACAATGTTCATCCAA

GTTTGCTCGACATGATAAATAGA

MdPIN13

ATGTTGGTGTCCCTTCCG

CTTTCCCCTCGATCGATC

MdLAX1

CATTCATCGTGGTGTGGGTGC

GCGGTGGTGGGGAGGCT

MdLAX2

CCATCCCTGGCCCACATTTTC

AGGGTGGCGGAGAGGAGGA

MdLAX3

GATTTGGATTCGGTGGGTGG

GGTATGGGAGTGATTACGAGGCAG

MdLAX4

ACACCGCCGCACCACTACC

GAAAACGAATACGGCAGTGTGAGAA

MdLAX5

CGTCAGCAATGGCAGCACA

GGAGAAAGAGTAGGGCAAAGTCAG

MdLAX6

CACCGTCTACATCATCCCATCTTTA

GCGGCTGCTAGTGGTGGTTTT

MdLAx7

CACCGTCTACATCATCCCATCTTTA

GAGCTGCGGCTGCTAGTGG

MdLAX8

GGTTCTGGTGATTGGGTTCGGGTTC

TGCGGCTGCTAGTGGCGGTTTT

Supplementary Table 4. Analysis of variance of MdPIN8, 10 and 13 gene expression in stem bark of Fuji/M9, Fuji/M9/Baleng Crab and Fuji/Baleng Crab. Means sharing the same letter are not significantly different (P > 0.05) between rows.

Material

Gene name

part

scion

interstock

rootstock

Fuji/M9

MdPIN8

5.947 a




2.922 b




MdPIN10

16.618 a




5.477 b




MdPIN13

6.989 a




0.727 b

Fuji/M9/Baleng Crab

MdPIN8

12.519 a

3.016 b

12.402 a




MdPIN10

5.936 a

6.049 a

4.867 a




MdPIN13

5.190 a

4.350 a

2.080 b

Fuji/Baleng Crab

MdPIN8

13.010 a




13.441 a




MdPIN10

16.066 a




13.108 a




MdPIN13

15.174 a




15.533 a

Supplementary Table 5. Analysis of variance of MdLAX1and 8 gene expression in stem bark of Fuji/M9, Fuji/M9/Baleng Crab and Fuji/Baleng Crab. Means sharing the same letter are not significantly different (P > 0.05) between rows.

Material

Gene name

site

scion

interstock

rootstock

Fuji/M9

MdLAX1

6.657 a




5.780 a




MdLAX8

2.025 b




4.382 b

Fuji/M9/Baleng Crab

MdLAX1

6.670 a

4.546 b

2.234c




MdLAX8

3.315 a

3.655 a

3.328 a

Fuji/Baleng Crab

MdLAX1

7.483 a




6.391 a




MdLAX8

7.110 b




9.466 a
  1   2   3


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©atelim.com 2016
rəhbərliyinə müraciət