Ana səhifə

Sequences of primers used for quantification by real-time polymerase chain reaction


Yüklə 14.14 Kb.
tarix27.06.2016
ölçüsü14.14 Kb.

Table S1. Sequences of primers used for quantification by real-time polymerase chain reaction

Primer name

Sequence (5′–3′)

Target

SmARF8-F

GCAAACCTTTTCTGATATGCTG

S. melongena; SmARF8

SmARF8-R

CGCTTTGATGATGAGGACGAAG




SmActin-F

GCTAGTGGTCGTACAACTGG

S. melongena; SmActin

SmActin-R

GGCATGTGGCAAAGCATAAC




SmARF8-R-F

CAGTTTCAACATCAACAGCGAACC

S. melongena; SmARF8

SmARF8-R-R

ACAAATGGAGTAACCCGAGAAG




Q-Ubce-F

AGGTACAGCGAGAGAAAGTAGCAGA

A. thaliana; ubiquitin

Q-Ubce-R

AACAGAAAAAGCAAGCTGAAAAACA




Q-ARF8-F

AACCATTGACACCGGAGGAG

A. thaliana; ARF8

Q-ARF8-R

GCTGCAGTGTGTAATCCAATGG




SmARF8-P1-F

TTGCTT GATAGGAGTTAGTTG

S. melongena; SmARF8-P1

SmARF8-P1-R

ATCACCATTAGGAAAACCAG




SmARF8-P2-F

TTTTCCTAATGGTGATATGG

S. melongena; SmARF8-P2

SmARF8-P2-R

ATCGAGTGACCGTCCAAAGG




SmARF8-P3-F

AAAGCGAATTGCTCTAGAATC

S. melongena; SmARF8-P3

SmARF8-P3-R

CAACTTAAGACACAACAGG




SmARF8-O-F

GGGGTTTTATACTTTTTGGGGTTGC

S. melongena; SmARF8

SmARF8-O-R

AGACTTGGCCCTTCCTCGTCTTTAG





Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©atelim.com 2016
rəhbərliyinə müraciət