Ana səhifə

Papa-mhci*01 gcggcgtggggc


Yüklə 26.92 Kb.
tarix24.06.2016
ölçüsü26.92 Kb.
Papa-MHCI*01 GCGGCGTGGGGCGACCCGAGGATGGCCGGCCGGAGAGAGCGGATTCCGGGCGCGTCGCGAAGAACCACCCAGATTTTCCGGTGGACACCGATGTCC

Papa-MHCI*02 .............................T........................A..T.......A..........C......A............

Papa-MHCI*03 .................................G..A............................G..........C......A............

Papa-MHCI*04 ..........CA.....................G..C...A......A......A..A.......A....G..A..C......A............

Papa-MHCI*05 .................................G.............TAC....A......A...AG......C...AAC...AGTC..C....G.

Papa-MHCI*06 ..............T..A...G........A..T......A.T.C.........GG.TC...G..AC................AG.C..TGC..G.

Pale AY909819 .A............T..AG..G.A......A..T......A.T.C.........GG.TC...G.GACA...............AG.CG.TGCC...

Pale AY909880 .A............T..AG..G.A......A..T......A.T.C.........GG.TC...G.GACA...............AG.CG.TGCC...

Pale AY909889 .A............T..AG..G.A......G..T......A.T.C.........GG.TC...G.GACA...............AG.CG.TGCC...

Pale AY909845 C..T.C..AC.....G..G..G.A.TT.....AG....A-AC....GAC...GA....C...GTG........CC.CG..CCTA..C..CGCC...

Pale AY909903 C..T.C..AC.....G..G..G.A.TT.....AG....A-AC....GAC...GA....C...GTG........CC.CG..CCTA..C..CGCC...

Pale AY909908 .................A.C.GAA............A.........GAC................G..........C......A............

Pale AY909907 ......A............A.GCT.......A.G..............AC.C...TTACTT.G..AC....TG...C......A............

Pale AY909875 .................A.C.GAA............A.........GAC..............CAA.....AG...C......A............

Pale AY909897 ...........................................C..GAC......TTAC...G..A................AAG.CGAC.C.G..

Pale AY909893 ..........CA.....................-..A..........A......A..A.......A....G..A..C......A............

Pale AY909887 .......A..CA........................A..........A......A..A.......A....G..A.........A............

Pale AY909886 ..........C......A.............A.....T..A.................C...GTG....G.....GC...CC.A..CG.CGCC...

Pale AY909878 .................................G...T................A..A.......A..........C...................

Pale AY909873 .................................-..A..........A......A..A.......A....G..A..C......A............

Pale AY909855 .................A.C.GAA............A.........GAC..............CAA.....AG...C......A............

Pale AY909840 .................................G...T................A..A.......G..........C...................

Pale AY909834 .............G...A..AGAA.............T........GAC........G.......G.......C..C...................

Pale AY909826 ..........CA.....................-..A..........A......A..A.......A....G..A..C......A............

Pale AY909816 ...........................................C..GAC......TTAC...G..A................AAG.CGAC.C.G..

Pale AY909813 ......A............A.GCT.......A.G..............AC.C....TACTT.G..AC....AG...C......A............

Pati HQ158007 ....T.....C.....T....TCT.............T.TC......A......A.......G..A.......AA..T....CAG.CGAC...GG.

Pati HQ158006 ....................AGAA.............T........GAC........T.......GT.........C...................

Pati HQ158005 .............................T..................AC....A..A.......A..........C...................

Pati HQ158004 ....................AGAA.............T........GAC........T.......GT.........C...................

Pati HQ158003 .................................G..A.................A......A...AG.........C..A.G.A..CG.CGCC...

Pati HQ158002 .................................G..A.................A.AT.......AG.........C..A.G.A..CG.CGCC...

Pati HQ158001 ....T..............A.GCT.............T.TT.............A..T.......AG.........C......A......T.....

Pati HQ158000 .............................T.......T........GAC........T.......AG.........C...................

Pati HQ157999 ..........C..........................T.TC.......AC....AA.T.......A..........C.............T.....

Pati HQ157998 .................................G..A........T.A......A..A.......A..........C...................

Pati HQ157997 .................................G..A.................A.AT.......AG.........C...................

Pati HQ157996 .................................G..A.................A.AT.......AG.........C...................

Pati HQ157994 .......................A......G..G..A.................A......A...AG......C...AAC...AGTCGTC.C.GG.

Pate AF283073 ..........C....T.A...................T..A.................C...GTG....G.....GC...CC.A..CG.CGCC...

Caca AF283078 ..........C......A...................T..A.................C...GTG....G.....GC...CC.A..CG.CGCC...

Caca AF283072 ..........C....T.A...................T..A.................C...GTG....G.....GC...CC.A..CG.CGCC...

Lege AF283083 ............A....................G.............A..T...C..........A.......A..C......A......T.....

Lege AF283071 ..........C....T.A...................T..A.................C...GTG....G.....GC...CC.A..CG.CGCC...

Lewi AF283074 ..........C....T.A...................T..A.................C...GTG....G.....GC...CC.A..CG.CGCC...

Lepa AF283081 ..........C......A.........C......CT.TA.C...C.GAC................AG......A.......C.A..CG.CGCC...

Lepa AF283082 ...................C.GAA.A...........T..........AC.C...TTACTT.G..AC.............................

Acju AJU07666 ..........C......................G.T............AC....A..A.......A.......C...AAC...AGTCGTC.C.GG.

Acju AJU07665 ..........C......................G.T............AC....A..A.......A.......A..C...................

Acju GU971407 ..........C..........TAT.........G..............AC....A..A.......A.......A..C...................

Acju GU971408 ..........C......................T.T............AC....A..A.......A.......A..C...................

Acju GU971409 .....................TAT.............T..A.............C..........A..A.......C...................

Acju GU971411 .....................TAT.............T..A.............C..........A..A.......C...................

Otma AF283069 ..........C....T.A...................T..A.................C...GTG....G.....GC...CC.A..CG.CGCC...

Fema AF283070 ..........C....T.A...................T..A.................C...GTG....G.....GC...CC.A..CG.CGCC...

Feca EU915359 .A...................TAT.........G...T.........AC....T.............................A............

Feca EU915360 ..T..............................G....................AG.T.......AC.......................T.....

Feca FCU07668 ...................C.GAA........................AC.C...TTACTT.G..AC.............................

Feca M26318 ...................C.GAA........................AC.....TTACTT.G..AC.........C......A......T.TG..

Feca AF283080 .T.................C.GAA.A...........T..........AC.C...TTACTT.G..AC.............................

Feca AF283076 .T.................C.GAA.A...........T..........AC.C...TTACTT.G..AC.............................

Feca FCU07674 ...................C.GAA........................AC.C...TTACTT.G..AC.............T..A..CG.CGCC...

Feca FCU07672 ...................C.GAA.........G...T..........AC.....TTACTT.G..AC................AG.GGAC.C.GGA

Feca FCU07670 ...................C.GAA........................AC.....TTACTT.G..AC.........C......A......T.TG..

Feca AF283079 ..........C....T.A..........A........T..A.................C...GTG....G.....GC...CC.A..CG.CGCC...

Feca AF283077 ..........C......A...................T..A.................C...GTG....G.....GC...CC.A..CG.CGCC...

Feca AF283075 ..........C....T.A......A............T..A.................C...GTG....G.....GC...CC.A..CG.CGCC...

Feca AF283068 ..........C....T.A...................T..A.................C...GTG....G.....GC...CC.A..CG.CGCC...

Feca U07673 ...................C.GAA..............................AG.T.......AC.......................T.....

Feca EU915358 ....T.....C.....T....TCT......G......T.TC......A......A.......G..A.......AA..T.....AG.CGAC...GG.

Feca EU915356 ...................C.GAA.............T........GAC................A..........C......A......T.....

Feca EU915355 .................................G............GA......A.AT.......AC.............................

Feca FCU07669 .................................G....................A.AT.......AC.............................


Supplementary Figure 1 Polymorphic nucleotides in feline MHC I exon 2 sequences aligned to the African leopard (Papa-MHCI*01; Genbank accession number HQ318105 ). Dots indicate identity to the top sequence. Minus (-) indicates indels. Motif identities distributed between the MHC I sequences are highlighted. Felid species included in the alignment correspond to Acju: Acinonyx jubatus, Feca: Felis catus, Fema: Felis margarita, Lege: Leopardus geoffroyi, Lepa: Leopardus pardalis, Lewi: Leopardus wiedii, Otma: Otocolobus manul, Pale: Panthera leo, Pati: Panthera tigris, Pate: Pardofelis temminckii, followed by their corresponding Genbank accession numbers.


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©atelim.com 2016
rəhbərliyinə müraciət