Ana səhifə

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза


Yüklə 307.8 Kb.
tarix24.06.2016
ölçüsü307.8 Kb.


На правах рукописи

САДОВСКАЯ ВЕРА АНАТОЛЬЕВНА



Особенности экспрессии изоформ мРНК лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза

14.03.09 «Клиническая иммунология, аллергология»

АВТОРЕФЕРАТ

Диссертации на соискание ученой степени

кандидата медицинских наук

Новосибирск 2013

Работа выполнена в Федеральном государственном бюджетном учреждении «Научно-исследовательский институт клинической иммунологии» Сибирского отделения Российской академии медицинских наук

Научный руководитель:

Доктор медицинских наук, профессор Сенников Сергей Витальевич



Официальные оппоненты:

Суховей Юрий Геннадьевич, доктор медицинских наук, профессор, Тюменский филиал Федерального Государственного Бюджетного Учреждения "Научно-исследовательский институт клинической иммунологии» Сибирского отделения Российской академии медицинских наук, директор

Шурлыгина Анна Вениаминовна, доктор медицинских наук, профессор, Федеральное государственное бюджетное учреждение «Научно-исследовательский институт физиологии» Сибирского отделения Российской академии медицинских наук, ведущий научный сотрудник лаборатории хронофизиологии

Ведущая организация:

Федеральное государственное бюджетное учреждение «Научно-исследовательский институт фармакологии» Сибирского отделения Российской академии медицинских наук (г. Томск)

Защита состоится «__»_________2013 г. В ___ часов на заседании диссертационного совета Д001.001.01 в ФГБУ «НИИ клинической иммунологии» СО РАМН по адресу: 630099, г. Новосибирск, ул. Ядринцевская, 14.

С диссертацией можно ознакомиться в библиотеке ФГБУ «НИИ клинической иммунологии» СО РАМН



Автореферат разослан «___»_________________2013г.

Ученый секретарь диссертационного совета

Кандидат медицинских наук Белогородцев Сергей Николаевич



ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы. В последнее время широко изучается значение альтернативного сплайсинга в иммунопоэзе в норме и при патологии. Определяется роль изоформ мРНК цитокинов в развитии не только иммунной системы, но и функционировании других систем организма. Например, показано значение и возможности коррекции патологии репродукции с помощью таких цитокинов, как LIF, IL-11 [Dimitriadis, 2007]. Многие аутоиммунные процессы связаны с изменением альтернативного сплайсинга вовлеченных в патогенез белков [Evsyukova, 2010]. Несомненно, является важным изучение особенностей альтернативного сплайсинга цитокинов, участвующих в развитии иммунной системы и органогенеза на ранних этапах развития, чтобы расширить представления о значении, распространении альтернативного сплайсинга в этих процессах, найти возможности поиска ранних маркеров нарушений развития. В настоящее время разрабатываются подходы специфической терапии, направленной на коррекцию процессинга мРНК при различных заболеваниях с использованием олигонуклеотидов, РНК-интерференции и других молекулярно-генетических методов, для чего тоже необходимо знание особенностей экспрессии изоформ мРНК.

Одними из основных факторов, участвующих в регуляции раннего иммунопоэза, являются лейкемия-ингибирующий фактор (LIF) и фактор стволовых клеток (SCF). Оба эти фактора играют важнейшую роль в пролиферации и созревании иммунокомпетентных клеток в печени, тимусе, костном мозге, а так же в процессах органогенеза. Эти цитокины являются основными медиаторами поддержания плюрипотентности эмбриональных стволовых клеток [Kristensen, 2005; Hirai, 2011].

В различных исследованиях была показана роль LIF в поддержании плюрипотентности и пролиферации эмбриональных стволовых клеток, в пролиферации тимоцитов, в регуляции количества миелоидных предшественников в костном мозге, активации гипоталамо-гипофизарно-адреналовой системы, при воспалении, стрессе и травме, в поддержании функций моторных нейронов, регуляции функций остеобластов [Escary, 1993; Patterson, 1994, Hirai, 2011; Sims, 2012]. При изучении процессов регуляции дифференцировки CD4+ клеток в разные классы Т-хелперов было показано, что LIF стимулирует образование регуляторных Т-клеток и подавляет индуцированную IL-6 продукцию IL-17 в Тх17, что является основой применения его рекомбинантных форм в терапии аутоиммунных заболеваний [Gao, 2009; Metcalfe, 2011]. Показано, что в тимусе уровень мРНК LIF, других цитокинов семейства IL-6 и SCF повышается с возрастом и коррелирует со снижением количества TREC в клетках тимуса. Предположительно, LIF и SCF участвуют в регуляции процессов инволюции тимуса [Sempowski, 2000]. В дополнении к этому LIF играет важную роль в образовании децидуальной ткани в эндометрии и имплантации, используется при лечении бесплодия [Dimitriadis, 2007]. Однако неясным остается, какова роль отдельных изоформ мРНК LIF в описанных процессах. При изучении экспрессии LIF у млекопитающих в различных тканях in vitro и in vivo было показано, что в результате транскрипции гена lif могут получаться три продукта. Эти транскрипты содержат альтернативные первые экзоны, соединенные с идентичными вторым и третьим экзонами [Rathjen, 1990]. Основные исследования экспрессии изоформ мРНК LIF проводились на мышах и клеточных линиях. Анализ транскриптов hLIF в культурах клеток человека выявил значительную вариабельность в профилях экспрессии. Исследований экспрессии сплайс-вариантов мРНК LIF у человека в период внутриутробного развития ранее не проводилось. Есть данные лишь об экспрессии LIF в фетальных яичниках человека [Abir, 2004]. Данные об экспрессии изоформ LIF могли бы прояснить характер альтернативного сплайсинга LIF человека в период раннего иммунопоэза прежде всего в таких органах, как тимус, селезенка и печень. Это необходимо для дальнейшего изучения регуляции альтернативного сплайсинга этого цитокина, изучения изменений спектра изоформ при различных патологических состояниях и изучения функциональных особенностей изоформ.

Другим важным фактором роста является фактор стволовых клеток (stem cell factor, SCF). Анализ экспрессии гена scf в развивающихся эмбрионах показал, что этот цитокин играет важную и разнообразную роль в онтогенезе иммунной системы и кроветворения. SCF так же экспрессируется в компартментах развития стволовых кроветворных клеток и участвует в регуляции развития, пролиферации и миграции клеток иммунопоэза, меланоцитов и половых клеток [Sette, 2000; Toksoz, 1992]. Экспрессия SCF наблюдается в стромальных и добавочных клетках из микроокружения гематопоэтических клеток, включая клетки эндотелия, моноциты, фибробласты. Вместе с LIF SCF является необходимым фактором для раннего развития Т-лимфоцитов [Liu, 2012]. Особую роль играет SCF в В-лимфопоэзе. Он участвует в регуляции ранних этапов развития В-клеток. Известна способность SCF усиливать пролиферацию незрелых дендритных клеток in vitro. В присутствии SCF и IL-2 из CD34+ клеток образуются НК-клетки [Anderson, 1990; Broudy, 1997; Takatsu, 1997; Ashman, 1999]. Белок SCF человека синтезируется в двух формах – мембранно-ассоциированной и растворимой. Эти изоформы образуются из двух сплайсированных мРНК, в одной из которых отсутствует шестой экзон. В большинстве исследований особенности экспрессии изоформ мРНК SCF человека изучались на клеточных линиях и в тканях во взрослом периоде в норме и при различных патологиях [Smith, 2001; Reber, 2006; Krasaqakis, 2011; Menq, 2012]. Было показано, что изоформы обладают разной биологической активностью [Miyazawa, 1995; Mauduit, 1999; Hutt, 2006]. Остаются неясными особенности синтеза разных изоформ мРНК SCF и их значение на этапе внутриутробного развития человека, когда наблюдается высокая активность экспрессии этого фактора при процессах органогенеза, раннего иммунопоэза.

Представляется актуальным изучить особенности экспрессии сплайс-изоформ этих двух ростовых факторов в тканях человека, участвующих в формировании гемо- и иммунопоэза во внутриутробном периоде, и определить изменения в спектре экспрессии изоформ в мононуклеарных клетках крови в течение онтогенеза.

Цель исследования. Изучить экспрессию сплайс-вариантов мРНК лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях человека и в мононуклеарных клетках периферической крови на разных этапах онтогенетического развития.

Задачи исследования:

1. Определить наличие сплайс-вариантов мРНК лейкемия-ингибирующего фактора в образцах фетальных тканей человека.

2. Выявить наличие и спектр экспрессии сплайс-вариантов мРНК лейкемия-ингибирующего фактора в мононуклеарных клетках периферической крови человека в пренатальный, неонатальный и постнатальный этапы развития.

3. Исследовать экспрессию сплайс-вариантов мРНК фактора стволовых клеток в различных фетальных тканях человека.

4. Изучить изменения экспрессии сплайс-вариантов мРНК фактора стволовых клеток в мононуклеарных клетках периферической крови человека на разных этапах онтогенетического развития: пренатальном, неонатальном и во взрослом периоде.

Научная новизна. Впервые изучен тканеспецифический характер экспрессии изоформ мРНК LIF в различных фетальных тканях человека. В тканях, участвующих в формировании гемо- и иммунопоэза (печень, селезенка и тимус), выявлены достоверные различия в экспрессии изоформ. Так, в печени, являющейся центральным органом гемопоэза во внутриутробном периоде, обнаружена высокая частота встречаемости экспрессии обоих сплайс-вариантов мРНК LIF, в селезенке экспрессия изоформ встречалась со средней частотой и определялась только мембранная изоформа мРНК LIF-M, в тимусе частота встречаемости экспрессии LIF была низкой и определялась только растворимая форма мРНК LIF-D.

В работе впервые охарактеризован спектр экспрессии изоформ мРНК LIF в мононуклеарных клетках крови человека в разные периоды онтогенетического развития. Показано достоверное снижение частоты встречаемости экспрессии изоформ мРНК LIF в мононуклеарных клетках крови новорожденных по сравнению с клетками плодов 22-х недель гестации. У взрослых доноров экспрессии не выявлено.

Впервые показан спектр экспрессии изоформ мРНК SCF в различных типах тканей на этапе внутриутробного развития человека. Это дополняет имеющиеся данные об экспрессии изоформ мРНК SCF в тканях во взрослом периоде развития. Впервые продемонстрирована стадиеспецифичность для экспрессии изоформ мРНК SCF в мононуклеарных клетках периферической крови человека на разных этапах развития. Частота встречаемости экспрессии изоформ мРНК SCF в этих клетках снижается от пренатального периода к неонатальному и исчезает во взрослом периоде развития.

Теоретическая и практическая значимость работы. В работе продемонстрировано, что экспрессия генов цитокинов LIF и SCF в фетальных тканях человека происходит с участием альтернативного сплайсинга. При этом наблюдается тканеспецифический характер экспрессии. Полученные результаты изучения экспрессии генов цитокинов позволяют расширить представления о полиморфизме цитокиновой сети. Показанные в работе факты экспрессии генов LIF и SCF человека в виде нескольких изоформ предоставляют новые данные об особенностях альтернативного сплайсинга этих цитокинов в период внутриутробного развития и в течение онтогенеза человека. Данные о тканеспецифическом и стадиеспецифическом характере экспрессии этих ростовых факторов у человека позволяют дифференцировать подходы к применению их рекомбинантных форм в терапии, учитывая характер альтернативного сплайсинга мРНК.

Положения, выносимые на защиту:

1. Экспрессия генов цитокинов lif и scf в фетальных тканях и мононуклеарных клетках периферической крови человека происходит с участием альтернативного сплайсинга.

2. Экспрессия изоформ мРНК цитокинов LIF и SCF человека имеет тканеспецифический и стадиеспецифический характер в онтогенезе.

Апробация материалов диссертации.

Материалы диссертации доложены и обсуждены на: 1) Межрегиональной научно-практической конференции «Дни иммунологии в Сибири» (Омск, 2007 г.); 2) Всероссийской научной конференции "Объединенный Иммунологический Форум" (Санкт-Петербург, 2008 г.). Апробация диссертации состоялась 26 октября 2012 г. на семинаре ФГБУ «НИИ клинической иммунологии» СО РАМН.



Публикации. По материалам диссертации опубликовано 4 печатных работы, в том числе 2 статьи в журналах, рекомендованных ВАК для публикации результатов работ соискателей ученой степени кандидата наук.

Объем и структура диссертации. Диссертация написана в традиционном стиле и состоит из введения, обзора литературы, описания материалов и методов исследования, описания собственных исследований, обсуждения полученных результатов, заключения и выводов. Материал изложен на 137 страницах машинописного текста, включающего 2 рисунка и 10 таблиц. Прилагаемая библиография содержит ссылки на 175 литературных источников, в том числе 168 зарубежных. Работа выполнена на базе лаборатории молекулярной иммунологии ФГБУ «НИИ клинической иммунологии» СО РАМН.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

Фетальные ткани и кровь плодов человека. В работе исследовали фетальные ткани (печени (n=7), селезенки (n=5), тимуса (n=6), яичников (n=5), семенников (n=4), почки (n=5), мозга (n=7), надпочечников (n=3) и зачатков зубов (n=3)) и кровь плодов (n=12) от относительно здоровых женщин (средний возраст 26 ± 3 лет), у которых беременность была прервана по социальным показаниям (средний срок гестации составил 20-22 недели). Прерывание беременности индуцировали путем интраамниального введения 25мг энзапроста. Отсутствие внутриутробной инфекции (герпес, гепатиты В и С, цитомегаловирус, и т.д.) у плода было подтверждено результатами бактериологического и гистологического исследования абортивного материала и последа. Образцы предоставлены из банка биоматериалов лаборатории клеточных биотехнологий (зав. лабораторией д.м.н. Селедцова Г.В.). Образцы тканей замораживались и хранились в жидком азоте. Кровь плодов собиралась в пробирки с 1 мл 0,5М ЭДТА.

Пуповинная кровь новорожденных. В исследование были включены женщины, у которых беременность завершилась срочными, самопроизвольными родами. Пуповинную кровь здоровых, доношенных новорожденных (n=13) в объеме 5-7 мл получали после пересечения пуповины, когда плацента еще находилась в полости матки (in uteri). Для этого дренировали пупочную вену, и кровь самотеком поступала в стерильную пробирку с 700 мкл 0,5 М ЭДТА.

Все исследования с фетальными тканями и плодовой/пуповинной кровью были одобрены Локальным этическим комитетом и проводились при наличии информированного согласия пациентов (номер протокола №72 от 26.09.2012г.).



Мононуклеарные клетки периферической крови человека. Источником мононуклеарных клеток (МНК) послужила венозная кровь доноров, пуповинная кровь новорожденных и кровь из сердца плодов на 20-22 неделях развития. МНК выделяли стандартным методом центрифугирования в градиенте плотности фиколл-урографина (ρ=1,082 г/л; фиколл (Pharmacia Fine Chemicl, Sweden), урографин (Шеринг АО, Германия)). Для этого 5 мл крови наслаивали на 3 мл раствора фиколл-урографина и центрифугировали при 3000 об/мин в течение 20 мин [30]. МНК, собранные из интерфазы, отмывали средой RPMI-1640 (ГНЦ ВБ «Вектор», г. Новосибирск) 3 раза путем ресуспендирования и последующего центрифугирования при 1000 оборотов/мин в течение 10 минут.

Выделение суммарной клеточной РНК. Суммарную РНК из фетальных тканей (печени (n=7), селезенки (n=5), тимуса (n=6), яичников (n=5), семенников (n=4), почки (n=5), мозга (n=7), надпочечников (n=3) и зачатков зубов (n=3)) выделяли методом фенольной экстракции. Образцы тканей растирали в ступке с жидким азотом до образования порошкообразной массы. Затем небольшое количество порошка (около 30-40 мкг) быстро переносили в стеклянные гомогенизаторы с денатурирующим раствором (4 М гуанидин тиоцианат (Fluka, Switzerland), 25 мМ цитрат натрия, рН 7,0; 0,5% саркозил (Sigma, USA); 0,1 М 2-βмеркаптоэтанол (Fluka, Switzerland)) и интенсивно гомогенизировали в течение 5-7 минут. Из полученного лизата отбирали 500 мкл и дальше выделяли РНК по стандартному протоколу. Свежевыделенные мононуклеарные клетки лизировали денатурирующим раствором из расчета 100 мкл денатурирующего раствора на 1Х106 клеток. К лизату последовательно добавляли 0,1 объема 2 М ацетата натрия (рН 4,0); 1 объем насыщенного водой фенола и 0,2 объема смеси хлороформ:изоамиловый спирт (49:1). Перед добавлением очередного компонента лизат тщательно перемешивали, переворачивая пробирки. Конечную суспензию интенсивно встряхивали на шейкере в течение 15 секунд, затем инкубировали на льду 30 мин. После инкубирования образцы центрифугировали для разделения фаз 20 мин при 12000 об/мин. Водную фазу отбирали, добавляли к ней равный объем изопропанола и помещали на -20°С для преципитации РНК. После повторного центрифугирования в течение 20 мин. при 12000 об/мин получившийся осадок РНК дважды отмывали в 75% этаноле. Осадок растворяли в деионизованной воде обработанной диэтилпирокарбонатом (0,01%) (Serva, Germany).

Качество выделенной РНК оценивали с помощью электрофореза в 1% агарозном геле (Chemapol, Чехия), приготовленном на трис-ацетатном буфере. Концентрацию и чистоту РНК оценивали на спектрофотометре "Милихром" при длинах волн 260 и 280 нм.



Реакция обратной транскрипции (ОТ). 10 мкл суммарной РНК денатурировали в присутствии 0,5мкг универсального праймера oligo(dT)16 при 70°С 5 минут и переносили на лед. Реакционная смесь содержала 10 мкл суммарной РНК, 0,5мкг oligo(dT)16 (Биосан, Новосибирск), 500 мкМ каждого dNTP (Sigma, USA), 25ед - M-MuLV обратной транскриптазы (Биосан, Новосибирск). Реакционный буфер прилагался к обратной транскиптазе и содержал 2 мM MnCl2, 20мМ Трис-HCI (рН 8,3 при 25°С), 100мM KCI, 1мМ дитиотрейтол (ДТТ). Реакцию проводили в объеме 20 мкл в течение 1,5 часов при 37°С, денатурировали фермент при 95°С 5 минут. Хранили полученные образцы кДНК при -20° С. Чтобы проконтролировать прохождение реакции ОТ с полученным продуктом и неревертированной РНК проводили ПЦР с праймеров, специфичных к последовательности гена GAPDH.

Полимеразная цепная реакция (ПЦР). ПЦР проводили в амплификаторе “PTC-200 DNA Engine” (MJ Research inc., USA). Реакционная смесь в объеме 20 мкл содержала 2 мкл смеси после реакции обратной транскрипции, 2 ед. Taq-ДНК полимеразы (Сибэнзим, Новосибирск), 0,5 мкМ каждого из праймеров, 250 мкМ смеси четырех dNTP. Реакционный буфер прилагался к ДНК-полимеразе и содержал 60мМ трис-НС1 (рН= 8,5 при 25° С), 100 мМ KCl, 1,5 мМ MgCl2, 10мМ 2-меркаптоэтанола, 1мM ДТТ. Режим термоциклирования зависел от состава праймеров и длины амплифицируемого фрагмента и рассчитывался с использованием программ «Primer Premier 5.0» и «Vector NTI 9.0»

Для повышения специфичности метода проводилась вложенная ПЦР с 1мкл смеси после первичной амплификации с другой парой праймеров. Продукты амплификации анализировали с помощью электрофореза в 1,5 или 2% агарозном геле, приготовленном на трис-ацетатном буфере (ТАЕ). В качестве маркера молекулярного веса использовали гидролизат плазмиды pUC19, полученный при расщеплении рестриктазой MspI (СибЭнзим, Новосибирск), негативными контролями служили препараты «неревертированной РНК» и реакция «без матрицы». После проведения электрофореза гель окрашивали водным раствором бромистого этидия (0,5 мкг/мл). Продукты полимеразной цепной реакции визуализировали в ультрафиолетовом свете, молекулярный вес фрагментов и интегральная оптическая плотность бэндов (IOD) оценивалась с помощью видеоденситометра и пакета прикладных программ “ImageMaster&VDS”(Pharmacia Biotech, USA).

Праймеры к последовательности гена GAPDH, LIF-D, LIF-M, LIF-T были синтезированы в фирме «Биосан», г. Новосибирск. Структура праймеров и термопрофили для первичной ПЦР были следующие:

LIF-D: 5’ – ataatgaaggtcttggcggcag

5’ – cggcgatgatctgcttatactt

Условия ПЦР: 95°C – 3 мин, 95°C – 20 сек, 63°C – 20 сек, 72°C – 30 сек, 40 циклов, 72°C – 3 мин, 25°C – 10 сек.

LIF-M: 5’ – ctggaagcgtgtggtctg

5’ – cggcgatgatctgcttatactt

Условия ПЦР: 95°C – 3 мин, 95°C – 30 сек, 61°C – 25 сек, 72°C – 30 сек, 40 циклов, 72°C – 3 мин, 25°C – 10 сек.

LIF-T: 5’ – cacctttcactttccttcctcc

5’ – cggcgatgatctgcttatactt

Условия ПЦР: 95°C – 3 мин, 95°C – 30 сек, 62°C – 30 сек, 72°C – 30 сек, 40 циклов, 72°C – 3 мин, 25°C – 10 сек.

SCF: 5’ – ccgaagggatctgcaggaatc

5’ – gtagcttacacttcttgaaactctctctc

Условия ПЦР: 95°C – 3 мин, 95°C – 30 сек, 65°C – 20 сек, 72°C – 30 сек, 40 циклов, 72°C – 3 мин, 25°C – 10 сек.

Для вложенной ПЦР структура праймеров и режимы термоциклирования были следующими:

LIF-D: 5’ – agtgccaatgccctctttatt

5’ – caaggtacacgactatgcggta

LIF-M: 5’ – gcagtgccaatgccctct

5’ – caaggtacacgactatgcggta

LIF-T: 5’ – cacccacctgcctatgacc

5’ – caaggtacacgactatgcggta

Условия ПЦР: 95°C – 3 мин, 95°C – 20 сек, 63°C – 20 сек, 72°C – 20 сек, 20 циклов, 72°C – 3 мин, 25°C – 10 сек.

SCF: 5’ – aaatcattcaagagcccagaaccc

5’ – ccagtataaggctccaaaagcaa

Условия ПЦР: 95°C – 3 мин, 95°C – 20 сек, 62°C – 30 сек, 72°C – 20 сек, 25 циклов, 72°C – 3 мин, 25°C – 10 сек.



Статистический анализ результатов. Статистическую обработку результатов исследования проводили, используя анализ таблиц частот и критерий х-квадрат в программе статистической обработки «Statistica 6.0».

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Экспрессия изоформ мРНК лейкемия-ингибирующего фактора в различных фетальных тканях человека.

В ранее выполненных исследованиях разных авторов экспрессия изоформ LIF в фетальных тканях изучалась лишь у мышей [Haines, 1999]. В нашей работе экспрессию изоформ мРНК LIF исследовали в различных фетальных тканях человека. Для этого получали образцы суммарной РНК, выделенной из ткани печени (n=7), селезенки (n=5), тимуса (n=6), яичников (n=5), семенников (n=4), почки (n=5), мозга (n=7), надпочечников (n=3) и зачатков зубов (n=3).

При анализе продуктов амплификации проводили электрофорез в агарозном геле на каждую изоформу отдельно. В результате вложенной ПЦР транскрипта LIF-D получался продукт размером 166 пар нуклеотидов, LIF-M – 168 п.н. На рисунке 1 проиллюстрированы результаты электрофореза продуктов амплификации LIF-D и LIF-M в различных образцах фетальных тканей и мононуклеарных клетках пуповинной крови новорожденных.

А




Рис. 1. Определение сплайс-форм мРНК LIF-D (А) и мРНК LIF-M (Б) в тканях плодов на сроке гестации 20-22 недель и в клетках пуповинной крови новорожденных. 1, 2, 3 – МНК пуповинной крови, 4, 5 – МНК крови плодов на 18-22 неделе развития, 6 – печень, 7, 8 – семенники, 9, 10 – щит. железа, 11, 12 – надпочечники, 13 – яичники, 14, 15 – ткани мозга, 16 – печень, 17, 18 – ткани десневых карманов, 19 – надпочечники, 20 - печень, 21 – надпочечники, 22 - селезенка. (Б) В результате вложенной амплификации транскрипта LIF-M в фетальных тканях и образцах пуповинной крови выявлялся специфичный фрагмент 168 п.н. М – маркер молекулярного веса pUC19/MspI.
Б

По результатам анализа продуктов амплификации в агарозном геле было выявлено, что экспрессия изоформ мРНК LIF имеет неоднородный характер и встречается не во всех исследуемых тканях. В таблице №1 приведены значения частот встречаемости изоформ LIF в фетальных тканях человека.

Для определения значимости различий в частотах встречаемости экспрессии изоформ был произведен статистический качественный анализ таблиц частоты определения экспрессии по критерию хи-квадрат.

Таблица 1.

Частота встречаемости альтернативных транскриптов LIF в фетальных тканях плодов 20-22 недель гестации.


Изоформы LIF

hLIF-D раствор.

hLIF-M

мембр.

hLIF-T


Фетальные ткани

Печень

7/7 (100%) *

3/7 (42.86%)

0/7

Тимус

1/6 (16.67%)

0/6 (0%)

0/6

Селезенка

0/5 (0%)

2/5 (40%)

0/5

Яичники

1/5 (20%)

1/5 (20%)

0/5

Семенники

1/4 (25%)

1/4 (25%)

0/4

Почка

0/5 (0%)

0/5 (0%)

0/5

Надпочечники

3/3 (100%)

2/3 (66.67%)

0/3

Мозг

2/7 (28.57%)

5/7(71.4%)

0/7

Зачатки зубов

2/3 (66.67%)

1/3 (33.33%)

0/3

Примечание: числитель дроби – количество выявленных положительных образцов, знаменатель – общее количество образцов.* -p<0,05 между изоформами.

По результатам статистического анализа было выявлено, что достоверным является преобладание экспрессии мРНК LIF-D в печени по сравнению с остальными типами тканей, за исключением тканей зачатков зубов и надпочечников. В зачатках зубов частота встречаемости мРНК LIF-D составляет 66,67%, что так же выше, чем в остальных образцах, но это не является достоверным, что связано с малым количеством образцов. В тканях почки экспрессии LIF не было обнаружено ни в одном из образцов, что совпадает с аналогичными исследованиями на мышах [Robertson, 1993]. В целом при рассмотрении частот экспрессии этих изоформ можно сделать вывод о тенденции в преобладании той или иной изоформы в определенном типе тканей, а именно: мРНК LIF-D чаще всего встречается в тканях печени, надпочечников, зачатков зубов, а мРНК LIF-M - в надпочечниках и тканях мозга.

В печени в период 20-22 недель внутриутробного развития активно идут процессы гемо- и иммунопоэза, одним из важных регуляторов которых является LIF. Экспрессия в печени обеих изоформ, отличающихся по частоте встречаемости, свидетельствует о наличии разных клеток-продуцентов. Экспрессия LIF в тимусе и селезенке не так часто встречается, как в печени и других вышеперечисленных тканях в изучаемый период развития. Вероятно, на сроке гестации 20-22 недели активность клеток-продуцентов LIF в этих органах только развивается и поэтому экспрессия обнаруживается не во всех образцах. По результатам вложенной ПЦР в тимусе встречается только растворимая изоформа мРНК LIF-D (16,7%), а в селезенке – мембранная LIF-M (40%). Это свидетельствует о том, что в процессах иммунопоэза и гистогенеза в этих органах за счет альтернативного сплайсинга изоформы LIF выполняют разные биологические функции и регуляция их экспрессии происходит независимо и по тканеспецифическому принципу. На основании этих данных можно так же предположить, что регуляция развития тимоцитов происходит преимущественно растворимой изоформой LIF-D, а в лимфопоэзе селезенки основную роль играет мембранная изоформа LIF-M. Известно, что с возрастом продукция LIF и SCF возрастает в тимусе, что связано с процессами инволюции тимуса [Sempowski,2000]. Вероятно, поэтому частота встречаемости экспрессии изоформ мРНК LIF на сроке гестации 20-22 недель имеет невысокий уровень. Так же вероятно, в процессах регуляции созревания тимоцитов и в процессах инволюции участвуют разные изоформы мРНК.

В изучаемый период развития активно идет развитие нервной системы, пролиферация и созревание нейронов, где одну из ключевых ролей играет LIF, чем, возможно, и объясняется его выраженная экспрессия в тканях мозга, причем в нашем исследовании чаще наблюдалась экспрессия мембранной изоформы (71,4%), чем растворимой (28,6%), хотя эти различия не были достоверными. По данным литературы известно, что LIF в тканях нервной системы продуцируется в основном клетками микроглии. Вероятно, эти клетки продуцируют мембранную изоформу и действуют паракринно. Учитывая данные литературы о том, что LIF играет одну из важнейших ролей в гаметогенезе, мы включили в исследование и ткани семенников и яичников плодов. В обоих типах образцов тканей наблюдалась экспрессия изоформ LIF – и мембранной, и растворимой – с одинаковой частотой. Это свидетельствует о том, что регуляция гаметогенеза в этих органах происходит под влиянием различных клеток, полиморфных по спектру экспрессии альтернативных изоформ LIF. Известна роль LIF в развитии гипоталамо-гипофизарно-адреналовой системы [Escary, 1993], чем вероятно и объясняется активность экспрессии в надпочечниках. Внутриклеточная изоформа мРНК LIF-T в образцах фетальных тканей не определялась.

Таким образом, показана избирательная экспрессия изоформ мРНК LIF в зависимости от типа тканей на сроке 20-22 недель внутриутробного развития человека. LIF преимущественно экспрессируется в тканях печени, селезенки, мозга, надпочечниках и тканях зачатков зубов. При этом типы преобладающей изоформы в тканях мозга, печени, тимуса и селезенки отличаются, что может указывать на различные биологические функции изоформ мРНК LIF.

Экспрессия изоформ мРНК лейкемия-ингибирующего фактора в мононуклеарных клетках человека на разных этапах развития.

Для изучения закономерностей экспрессии в процессе онтогенетического развития организма, на следующем этапе изучали спектр экспрессии изоформ мРНК LIF в мононуклеарных клетках крови в разные периоды развития. Для этого исследовались образцы крови, полученные от плодов 20-22 недель внутриутробного развития, пуповинная кровь новорожденных и венозная кровь взрослых условно-здоровых доноров.

Как следует из данных табл. 2, во всех образцах МНК крови плодов на 20-22 неделях развития выявлялись изоформы мРНК LIF-D и LIF-M и лишь в одном из образцов – LIF-T.

Таблица 2.

Частота встречаемости альтернативных транскриптов LIF в МНК крови на разных этапах онтогенеза.

Изоформы мРНК LIF

hLIF-D растворимая

hLIF-M

мембранная

hLIF-T

внутриклет.

МНК крови плодов

20-22 недель, n=5



5/5 (100%)*

5/5 (100%)*

1/5 (20%)

МНК пуповинной крови новорожденных, n=13

4/13 (30,8%)

5/13(38,5%)

0/13(0%)

МНК периферической крови взрослых, n=15

0/15

0/15

0/15

Примечание: числитель дроби – количество выявленных положительных образцов, знаменатель – общее количество образцов.

Показаны достоверные различия в частоте встречаемости изоформ в разные периоды развития. Во всех изученных образцах крови, собранных в пренатальном периоде, встречаются изоформы LIF. К моменту рождения частота встречаемости в периферической крови снижается и практически исчезает у взрослых доноров. Причем данная закономерность характерна для обеих изоформ мРНК LIF-D и LIF-M. Вероятно, это связано с тем, что в этот период наблюдается высокая активность процессов роста и развития организма и в крови циркулирует множество различных регуляторных клеток, экспрессирующих факторы роста, такие как LIF. Эти клетки различаются экспрессией альтернативных транскриптов, что так же необходимо для разнонаправленной регуляции клеток-мишеней. Так же наличие в периферической крови обеих изоформ может свидетельствовать об активной миграции клеток-продуцентов LIF из печени, где так же встречаются обе изоформы, в тимус и селезенку и другие ткани. По результатам анализа экспрессии мРНК этого цитокина в МНК, выделенных из пуповинной крови, было показано, что экспрессия LIF носит разнородный характер и отличается у разных новорожденных. При этом в большинстве случаев экспрессия LIF не выявлялась, а в тех образцах, где она была позитивной, выявлялись обе изоформы мРНК LIF-D и LIF-M одновременно. Это свидетельствует о том, что к моменту рождения количество клеток, экспрессирующих LIF в периферической крови уменьшается и они, вероятно, заселяют ткани, где участвуют в дальнейшей регуляции процессов развития. Так же, возможно, снижение встречаемости клеток-продуцентов в крови является проявлением общего снижения активности процессов пролиферации и органогенеза, регулируемых с участием LIF. В МНК периферической крови 15 взрослых доноров транскриптов LIF не было выявлено. По данным других авторов известно, что в некоторых тканях во взрослом периоде изоформы LIF присутствуют, что говорит о том, что продукция LIF в постнатальном периоде в основном осуществляется в тканях [Auernhammer and Melmed, 2000]. Внутриклеточная изоформа мРНК LIF-T была обнаружена лишь в одной из проб периферической крови плодов. Вероятно, что уровень активности экспрессии внутриклеточной изоформы в разных тканях и клетках зависит от различных стимулирующих факторов со стороны микроокружения. То есть ее экспрессия не является конститутивной, а начинается только в ответ на какие-то сигналы.

Таким образом, наблюдается снижение уровня встречаемости экспрессии этих изоформ в пуле мононуклеарных клеток крови от пренатального к постнатальному периодам развития человека. Учитывая вышесказанное, можно предположить, что клетки-продуценты LIF в период внутриутробного развития активно мигрируют в пуле периферической крови, распространяясь по всему организму, а к моменту рождения и некоторое время после этого они заселяют ткани и исчезают из кровотока.

Экспрессия изоформ мРНК фактора стволовых клеток в различных фетальных тканях человека.

Ранее исследователями было установлено наличие двух сплайс-форм мРНК SCF в клетках человека, которые кодируют растворимую и мембраносвязанные формы SCF [Huang, 1992]. В нашей работе впервые определялось наличие мРНК двух изоформ SCF в различных тканях гемо- и иммунопоэза, а так же гаметогенеза на этапе внутриутробного развития человека.

В работе исследовались образцы суммарной РНК, выделенной из ткани печени (n=7), селезенки (n=5), тимуса (n=6), яичников (n=5), семенников (n=4), почки (n=5), мозга (n=7), надпочечников (n=3) и зачатков зубов (n=3). Выявление транскриптов изоформ SCF проводили с использованием двухраундной ПЦР с «вложенными» праймерами, для повышения чувствительности и специфичности детекции.

На рисунке 2 представлены результаты детекции продуктов амплификации SCF в агарозном геле.

А
Рис. 2. Определение изоформ мРНК SCF в тканях плодов на сроке гестации 18-20 недель(A) и в клетках пуповинной крови новорожденных (Б). В результате вложенной ПЦР получалось два продукта: 339 п.н. (растворимая изоформа) и 225 п.н.(мембранная изоформа). А. 1, 2 – МНК плодов, 3 – печень, 4, 5 – семенники, 6, 7 – мозг, 8, 9 – надпочечники, 10 - яичники, 11, 12 – мозг, 13 – печень, 14, 15 – зачатки зубов, 16 – надпочечники, 17 – тимус; М – маркер молекулярного веса pUC19/MspI. Б. 1-5 – образцы МНК пуповинной крови от разных доноров.

Б

Ранние исследования показали, что этот фактор является одним из ключевых регуляторов развития тимоцитов, раннего развития предшественников В-лимфоцитов и нормального функционирования системы гемопоэза [Toksoz, 1992; Smith, 2001]. Особо важен тот факт, что ключевую роль в вышеперечисленных функциях выполняет мембраносвязанная изоформа SCF, а направленность регуляторных реакций модулируется как балансом мембранной и растворимой изоформ самого SCF, так и изоформами его рецептора C-KIT. Во всех изученных типах тканей, кроме тканей зачатков зубов, была выявлена экспрессия обеих изоформ мРНК SCF, что свидетельствует о полиморфности клеток-продуцентов фактора в этих тканях и разнонаправленном регуляторном действии этого цитокина в пренатальный период развития. Полученные результаты представлены в таблице №3.

В тканях фетального иммунопоэза и гемопоэза наиболее часто экспрессия обеих изоформ SCF, как и LIF, выявлялась в образцах печени, причем преобладала растворимая форма, что соответствует важной роли этого цитокина как фактора гемопоэза. Преобладание экспрессии изоформ SCF в печени в период 20-22 недель может объясняться тем, что процессы миграции регуляторных клеток в центральные органы иммунопоэза еще не завершились и печень является ключевым органом гемо- и иммунопоэза. Подтверждением этого служит еще тот факт, что в период внутриутробного развития обе изоформы мРНК часто встречаются и в мононуклеарных клетках периферической крови, а во взрослом периоде частота встречаемости этих изоформ в пуле МНК резко уменьшается. При этом по данным литературы в тканях экспрессия изоформ SCF продолжается и во взрослом периоде. Это может быть обусловлено тем, что именно во внутриутробном и неонатальном периодах идут активные процессы миграции клеток-продуцентов этого фактора в ткани, где они потом выполняют свои функции в регуляторных процессах, прежде всего как регуляторы функций стволовых клеток.


Таблица 3.

Частота встречаемости сплайс-изоформ мРНК SCF в фетальных тканях плодов 20-22 недель гестации.

Фетальные ткани

SCF растворимый

SCF мембранный

Печень

5/7 (71,4%)

4/7 (57,1%)

Тимус

4/6 (66,7%)

2/6 (33,3%)

Селезенка

2/5 (40%)

2/5 (40%)

Яичники

2/5 (40%)

2/5 (40%)

Семенники

3/4 (75%)

3/4 (75%)

Почка

3/5 (60%)

2/5 (40%)

Надпочечники

3/3 (100%)

3/3 (100%)

Мозг

5/7 (71,4%)

5/7 (71,4%)

Зачатки зубов

1/3 (33,3%)

0/3

Примечание: числитель дроби – количество выявленных положительных образцов, знаменатель – общее количество образцов.

Учитывая, что SCF играет важную роль в поддержании пролиферативной активности стволовых клеток, а во время пренатального развития высокая активность пролиферации тканевых стволовых клеток регистрируется в тканях зачатков зубов, представлялось закономерным исследовать наличие изоформ SCF в этих тканях. Однако исследование трех образцов этих тканей показало, в отличие от LIF, что только в одном случае обнаружилась экспрессия растворимой изоформы мРНК SCF. Возможно, это объясняется тем, что уровень экспрессии меняется в течение внутриутробного развития и зависит от срока гестации, а так же более строгой тканеспецифичностью альтернативного сплайсинга в изученном компартменте.

Известно, что SCF играет важную роль в процессах сперматогенеза и оогенеза, регулируя активность половых клеток. Поэтому особо важным было изучение альтернативного сплайсинга мРНК SCF в тканях семенников и яичников. Как видно из данных табл. 3, в этих тканях экспрессируется как растворимая, так и мембранная формы SCF, причем уровень экспрессии обеих изоформ в семенниках и яичниках был сопоставим.

Статистический анализ достоверности показал недостоверные отличия между частотами встречаемости экспрессии изоформ мРНК SCF в фетальных тканях. При этом наблюдалась неоднородность экспрессии изоформ в пределах одного организма. В одном случае у плода в тканях печени выявлялась экспрессия обеих изоформ тогда, как у этого же плода в почках была выявлена только растворимая форма SCF. В другом случае у плода наблюдалась выраженная экспрессия обеих изоформ в семенниках в отличие от тканей зачатков зубов, где экспрессии не было обнаружено. Подобные данные свидетельствуют о тканеспецифическом характере регуляции альтернативного сплайсинга SCF и, возможно, о зависимости экспрессии той или иной формы от физиологического состояния плода.



Экспрессия изоформ мРНК фактора стволовых клеток в мононуклеарных клетках человека на разных этапах развития.

На следующем этапе исследований изучались изменения экспрессии мРНК SCF в зависимости от стадии развития организма. С этой целью изучали наличие изоформ мРНК SCF в мононуклеарных клетках крови плодов на 20-22 неделях внутриутробного развития, пуповинной крови новорожденных и периферической крови взрослых.

В изученных образцах МНК плодов выявлялась выраженная экспрессия обеих изоформ мРНК SCF, в то время как в МНК периферической крови взрослых доноров мы не выявили ни растворимую, ни мембранную изоформы. Анализ 13-ти образцов пуповинной крови показал, что в пяти из них экспрессия мРНК SCF была положительной, причем в двух из этих проб обнаруживался фрагмент, соответствующий только мембранной изоформе. Полученные данные суммированы в таблице № 4.

Таблица 4.

Частота встречаемости сплайс-изоформ мРНК SCF в МНК крови на разных этапах онтогенеза.


Изоформы мРНК SCF

SCF растворимый

SCF мембранный

МНК крови плодов

20-22 недель, N=5



5/5(100%)

5/5(100%)

МНК пуповинной крови новорожденных, N=13

3/13(23,1%)

5/13(38,5%)

МНК периферической крови взрослых, N=15

0/15

0/15

Примечание: числитель дроби – количество выявленных положительных образцов, знаменатель – общее количество образцов.

Статистический анализ достоверности различий встречаемости экспрессии изоформ SCF на разных этапах онтогенеза показал, что снижение частоты встречаемости растворимой изоформы в неонатальном периоде было статистически значимым (p<0,05), в то время как снижение частоты мембранной формы в этот период развития имело характер выраженной тенденции (p>0,05). Несмотря на практически двукратное увеличение экспрессии мембранной изоформы в пуповинной крови по сравнению с растворимой формой (38,5 против 23,1%, соответственно), эти различия были недостоверными.

Наличие изоформ мРНК фактора стволовых клеток в периферической крови в антенатальный и неонатальный периоды и отсутствие их во взрослом периоде объясняется более активными процессами пролиферации и развития во внутриутробный период, а так же переключением органов гемопоэза, миграцией предшественников в костный мозг и преимущественной локализацией клеток-продуцентов во взрослом периоде в тканях. Причем, небольшое преобладание мембранной изоформы в неонатальный период может быть связано с функциональными особенностями мигрирующих клеток, и свидетельствует о различном биологическом значении изоформ. Возможно, преобладание клеток, экспрессирующих эту изоформу, в периферической крови свидетельствует об активной миграции клеток-предшественников гемо- и иммунопоэза, так как в этот период внутриутробного развития происходит процесс переключения с фетального эритропоэза на неонатальный, активно мигрируют клетки-предшественники тимопоэза и стволовые гемопоэтические клетки.



В результате анализа проведенных исследований можно утверждать, что экспрессия сплайс-вариантов мРНК SCF имеет дифференцированный тканеспецифический характер в пределах одного организма и широко распространена во многих типах тканей в пренатальный период развития человека. Частота и спектр экспрессии изоформ мРНК SCF в мононуклеарных клетках крови указывает на стадиеспецифичность экспрессии этого цитокина и наиболее выражены во внутриутробный период и в периоде новорожденности. Это связано, прежде всего, с тем, что с возрастом основная продукция этого фактора происходит в тканях. Результаты исследования экспрессии генов LIF и SCF в фетальных тканях человека показывают, что экспрессия указанных генов происходит с участием альтернативного сплайсинга. В некоторых случаях спектр сплайс-форм мРНК, выявляемый в фетальных тканях, соответствует спектру сплайс-форм, описанному у взрослого человека. Для генов цитокинов характерна тканеспецифичность экспрессии сплайс-вариантов выявляемая как для разных тканей одного организма, так и для одной ткани разных организмов. Исследование экспрессии сплайс-форм мРНК цитокинов в МНК на разных стадиях онтогенеза свидетельствует о значимом вкладе сплайс-вариантов цитокинов в регуляцию гистогенеза.
ВЫВОДЫ


  1. Показано, что экспрессия гена lif в фетальных тканях человека проходит с участием альтернативного сплайсинга с образованием изоформ мРНК LIF-D и LIF-M и имеет качественные отличия в разных тканях, что свидетельствует о тканеспецифическом характере альтернативного сплайсинга этого фактора.




  1. В мононуклеарных клетках периферической крови человека частота встречаемости экспрессии изоформ мРНК LIF снижается в течение онтогенетического развития, что свидетельствует о снижении экспрессии мРНК LIF в этих клетках в онтогенезе.




  1. Продемонстрировано, что экспрессия обеих изоформ мРНК SCF широко распространена во многих типах фетальных тканей человека и имеет разные частоты встречаемости в зависимости от типа тканей, что указывает на тканеспецифический характер экспрессии этого цитокина.




  1. При изучении экспрессии изоформ мРНК SCF в мононуклеарных клетках периферической крови в пренатальный, неонатальный и постнатальный периоды было выявлено достоверное снижение частоты встречаемости мРНК как мембранной, так и растворимой форм SCF, что свидетельствует о снижении активности экспрессии этого фактора в клетках-продуцентах периферической крови в течение онтогенетического развития.



ПУБЛИКАЦИИ ПО ТЕМЕ ДИССЕРТАЦИИ


  1. Садовская В.А., Сенников С.В., Останин А.А., Селедцова Г.В., Силков А.Н., Козлов В.А. Онтогенетические особенности экспрессии изоформ мРНК фактора, ингибирующего лейкоз, в фетальных тканях и мононуклеарных клетках человека // Клеточные технологии в биологии и медицине. – 2009 г. – № 2. – Стр. 85-89.

  2. Садовская В.А., Сенников С.В., Селедцова Г.В., Силков А.Н., Козлов В.А. Особенности экспрессии изоформ мРНК фактора стволовых клеток в фетальных тканях и мононуклеарных клетках на разных этапах развития человека // Клеточные технологии в биологии и медицине. – 2010 г. – № 3. – Стр. 138-141.

  3. Садовская В.А., Самарин Д.М., Селедцова Г.В., Останин А.А., Силков А.Н., Сенников С.В., Козлов В.А. Изучение тканеспецифичности экспрессии альтернативных форм мРНК SCF, LIF в пренатальном периоде развития. // Материалы межрегиональной научно-практической конференции «Дни иммунологии в Сибири». Омский научный вестник. – 2007 г. – №3(61), приложение 2. – Стр. 159.

  4. Садовская В.А., Селедцова Г.В., Останин А.А., Силков А.Н., Сенников С.В., Козлов В.А. Исследование экспрессии изоформ мРНК SCF и LIF в фетальных тканях и в мононуклеарных клетках крови на разных этапах развития человека.// «Российский иммунологический журнал». Материалы Объединенного иммунологического форума, Санкт-Петербург, 2008.– Том 2(11). – №2-3. – стр. 135.




Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©atelim.com 2016
rəhbərliyinə müraciət