Ana səhifə

MiR-203 inhibits proliferation and self-renewal of leukemia stem cells by targeting survivin and Bmi-1


Yüklə 29.83 Kb.
tarix24.06.2016
ölçüsü29.83 Kb.
miR-203 inhibits proliferation and self-renewal of leukemia stem cells by targeting survivin and Bmi-1
Yi Zhang1,2*,7, Shu-yan Zhou3*, Hai-zhao Yan1,Dan-dan Xu1, Hai-xuan Chen4, Xiao-yan Wang2, Xiao Wang2, Yu-ting Liu1, Li Zhang1, Sheng Wang1, Peng-jun Zhou5, Wu-yu Fu5, Bi-bo Ruan5,Dong-lei Ma1, Ying Wang1, Qiu-ying Liu2, Zhe Ren2, Zhong Liu2, Rong Zhang6§, Yi-fei Wang1,2§

1College of life science and technology, Jinan University, Guangzhou, 510632, P.R. China

2Institute of Biomedicine, Jinan University, Guangzhou, 510632, P.R. China

3Department of Pathological Physiology, Wan-nan Medical College,Wuhu, 241000,

 P.R. China



4College of medicine, Jinan University, Guangzhou, 510632, P.R. China

5Guangdong Pharmaceutical University

6Department of Endoscopy, Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China,Collaborative Innovation Center for Cancer Medicine,
Guangzhou, 510632, P.R. China

7Section of Otolaryngology, Department of Surgery, Yale School of Medicine

*These authors contributed equally to this work



§Corresponding author
Email Address:

Yi Zhang: scholarzy@163.com

Shu-yan Zhou: zhoushuyan_xju2005@126.com

Hai-zhao Yan: yanhaizhao@126.com

Dan-danXu: Junxu98@163.com

Hai-xuan Chen: chx00520@163.com

Xiao-yan Wang: wangxiaoyan_1016@163.com

Xiao Wang: wangxiao0719@163.com

Yu-ting Liu: ziziniu@163.com

Li Zhang: 15692002254@163.com

Sheng Wang: 18520215232@163.com

Peng-jun Zhou: zhouzhang1990@163.com

Wu-yu Fu: fuwuyu2014@163.com

Bi-boRuan: 15011931237@163.com

Dong-lei Ma: donglei131001@163.com

Ying Wang: wy1005swau@aliyun.com

Qiu-ying Liu: qiuying_liu@126.com

ZheRen: rz62@163.com

Zhong Liu: tliuzh@jnu.edu.cn

Rong Zhang: zhangrong@sysucc.org.cn

Yi-fei Wang: twang-yf@163.com

(0086-021-85220504)

Table S1. Demographics and clinical characteristics of 50 newly diagnosed AML patients in this study



Characteristics (n)

miR-203

CD34+ expression, n (%) CD34- expression, n (%)

Sex




Female (29)

18 (62%) 11 (38%)

Male (21)

7 (33%) 14 (67%)

Pvalue

0.157

Age




≤40 years old (37)

23 (62%) 14 (38%)

>40 years old (13)

6 (46%) 7 (54%)

Pvalue

0.165

FAB




M0 (7)

3 (43%) 4 (57%)

M1 (10)

2 (20%) 8 (80%)

M2 (11)

4 (36%) 7 (64%)

M5 (13)

7 (54%) 6 (46%)

M7 (9)

6 (67%) 3 (33%)

Pvalue

0.212

Laboratory analysis (median)




WBC (109/L)

24.3 17.2

Platelet (109/L)

5648

Hemoglobin (g/dL)

12.89.3

BM blast, %

4532

PB blast, %

23 14

Pvalue

0.189

Abbreviations: FAB, French-American-Britain subtype; WBC, white blood cell; LDH, lactate dehydrogenase; BM, bone marrow; PB, peripheral blood. *Fisher’s exact test was used.

Table S2. Primers for qRT-PCR

Construct Primer sequences (5’-3’)

Survivin
Bmi-1
FLT3
WT1
ABCG2
GAPDH


F: CACCGCATCTCTACATTCAAGA

R: AAGTCTGGCTCGTTCTCAGTG

F: GGCTCTAATGAAGATAGAGGAG

R: TCACAGTCATTGCTGCTGGGCA



F: GATAGTCACTGAATTCGGTCTTGGA

R: GACATTCTCTGCCACAGAAAACAGC

F: TTACTGGGTGAGGAAATCCA

R: AGATCAACACCCAGTGATGC

F: TCAATCAAAGTGCTTCTTTTTTATG

R: TTGTGGAAGAATCACGTGGC

F: AACGGATTTGGTCGTATTGGG

R: TCGCTCCTGGAAGATGGTGAT



Supplemental Figure Legends

Supplemental Fig.1 qRT-PCR of miR-203 expression levels

miR-203 levels were detected after transfection a miR-203 mimic 48h in LSC-enriched



KG-1a and MOLM-13 cell lines and referenced against RNU6B.




Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©atelim.com 2016
rəhbərliyinə müraciət