Ana səhifə

Locus Name Use Sequence


Yüklə 29.11 Kb.
tarix27.06.2016
ölçüsü29.11 Kb.

Locus

Name

Use

Sequence (5’3')

Citation

18S

18e-s

Amp/Seq

ctggttgatcctgccagt

1

18S

18p-c

Amp/Seq

taatgatccttccgcaggttcacct

1

18S

18S1.2f

Seq

TGCTTGTCTCAAAGATTAAGC

2

18S

r1138

Amp/Seq

GTTAGAGGTTCGAAGGCG

3

18S

f1094

Amp/Seq

GGATCGTCGCAAGACGGACAGAAG

3

28S

rD4.2b

Amp/Seq

CCTTGGTCCGTGTTTCAAGACGG

2

28S

rD5b

Amp/Seq

CCACAGCGCCAGTTCTGCTTAC

2

28S

ZX1

Amp/Seq

ACCCGCTGAATTTAAGCATAT

4

28S

OP2

Amp/Seq

cagactagagtcaagctcaacagg

5

28S

ZR1

Seq

gtcttgaaacacggaccaaggagtct

5

EF-1

Cho10(mod)

Amp

ACRGCVACKGTYTGHCKCATGTC

6

EF-1

Cho10rev1

Amp/Seq

AGCATCDCCAGAYTTGATRGC

7

EF-1

efa747

Amp/Seq

CCACCAATTTTGTAGACATC

8

EF-1

efs372

Amp/Seq

CTGGTGAATTTGAAGCYGGTA

9

EF-1

for1deg

Amp/Seq

GYATCGACAARCGTACSATYG

6



Literature Cited for Table S2





  1. Halaynch K, Lutz RA, Vrijenhoek RC (1998) Evolutionary origins and age of vestimentiferan tube-worms. Cah Biol Mar 39: 355–358.

  2. Whiting MF (2002b) Mecoptera is paraphyletic: multiple genes and phylogeny of Mecoptera and Siphonaptera. Zool Scr 31: 93–104.

  3. Sequeira AS, Normark BB, Farrell BD (2000) Evolutionary assembly of the conifer fauna: Distinguishing ancient from recent associations in bark beetles. Proc R Soc Lond B Biol Sci 267: 2359–2366.

  4. Van der Auwera G, Chapelle S, De Wachter R (1994) Structure of the large ribosomal subunit RNA of Phytophthora megasperma, and phylogeny of the Oomycetes. FEBS Lett 338: 133–136.

  5. Mallatt J, Sullivan J (1998) 28S and 18S ribosomal DNA sequences support the monophyly of lampreys and hagfishes. Mol Biol Evol 15: 1706–1718.

  6. Danforth BN, Ji S (1998) Elongation factor–1alpha occurs as two copies in bees: Implications for phylogenetic analysis of EF–1alpha sequences in insects. Mol Biol Evol 15: 225–235.

  7. McKenna DD, Sequeira AS, Marvaldi AE, Farrell BD (2009) Temporal lags and overlap in the diversification of weevils and flowering plant. Proc Natl Acad Sci USA 106: 7083-7088.

  8. Normark BB, Jordal BH, Farrell BD (1999) Origin of a haplodiploid beetle lineage. Proc R Soc Lond B Biol Sci 266: 2253–2259.

  9. McKenna DD, Farrell BD (2005) Molecular phylogenetics and evolution of host plant use in the Neotropical rolled leaf 'hispine' beetle genus Cephaloleia (Chevrolat) (Chrysomelidae: Cassidinae). Mol Phylogenet Evol 37: 117–131.


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©atelim.com 2016
rəhbərliyinə müraciət